ID: 992160783

View in Genome Browser
Species Human (GRCh38)
Location 5:73999140-73999162
Sequence TCGCCACACATTAATGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992160783_992160786 -5 Left 992160783 5:73999140-73999162 CCTCCCACATTAATGTGTGGCGA No data
Right 992160786 5:73999158-73999180 GGCGAGTCCCATTGTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992160783 Original CRISPR TCGCCACACATTAATGTGGG AGG (reversed) Intergenic
No off target data available for this crispr