ID: 992160787

View in Genome Browser
Species Human (GRCh38)
Location 5:73999165-73999187
Sequence CAGGTATCCTAGAGGACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992160787_992160791 18 Left 992160787 5:73999165-73999187 CCCATTGTCCTCTAGGATACCTG No data
Right 992160791 5:73999206-73999228 AAATGTGTTCCTTCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992160787 Original CRISPR CAGGTATCCTAGAGGACAAT GGG (reversed) Intergenic
No off target data available for this crispr