ID: 992162541

View in Genome Browser
Species Human (GRCh38)
Location 5:74016866-74016888
Sequence CAGTGTAAGGGGGAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992162534_992162541 -5 Left 992162534 5:74016848-74016870 CCCGCAGATGGGAGATGACAGTG No data
Right 992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG No data
992162531_992162541 28 Left 992162531 5:74016815-74016837 CCTTTCTTTCTCTGCTTCTCTCA No data
Right 992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG No data
992162535_992162541 -6 Left 992162535 5:74016849-74016871 CCGCAGATGGGAGATGACAGTGT No data
Right 992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992162541 Original CRISPR CAGTGTAAGGGGGAGGTGAA TGG Intergenic
No off target data available for this crispr