ID: 992164042

View in Genome Browser
Species Human (GRCh38)
Location 5:74031092-74031114
Sequence ACCAACAAAAGCAGCCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992164042_992164048 28 Left 992164042 5:74031092-74031114 CCACCGGGGCTGCTTTTGTTGGT No data
Right 992164048 5:74031143-74031165 TACCGCCTTTGATCAGACCTAGG No data
992164042_992164046 -9 Left 992164042 5:74031092-74031114 CCACCGGGGCTGCTTTTGTTGGT No data
Right 992164046 5:74031106-74031128 TTTGTTGGTCAGATGTGGAAGGG No data
992164042_992164045 -10 Left 992164042 5:74031092-74031114 CCACCGGGGCTGCTTTTGTTGGT No data
Right 992164045 5:74031105-74031127 TTTTGTTGGTCAGATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992164042 Original CRISPR ACCAACAAAAGCAGCCCCGG TGG (reversed) Intergenic