ID: 992167950

View in Genome Browser
Species Human (GRCh38)
Location 5:74073527-74073549
Sequence TTGGCTACACCCACCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992167945_992167950 17 Left 992167945 5:74073487-74073509 CCCTTGAGTTGGAGCTGAGGGAG No data
Right 992167950 5:74073527-74073549 TTGGCTACACCCACCCAGAGTGG No data
992167946_992167950 16 Left 992167946 5:74073488-74073510 CCTTGAGTTGGAGCTGAGGGAGA No data
Right 992167950 5:74073527-74073549 TTGGCTACACCCACCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992167950 Original CRISPR TTGGCTACACCCACCCAGAG TGG Intergenic
No off target data available for this crispr