ID: 992170150

View in Genome Browser
Species Human (GRCh38)
Location 5:74093355-74093377
Sequence CTTTCTCTGCTGCAGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992170148_992170150 4 Left 992170148 5:74093328-74093350 CCTGGGTAAAGAATGGAGGTTTT No data
Right 992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG No data
992170145_992170150 10 Left 992170145 5:74093322-74093344 CCATTCCCTGGGTAAAGAATGGA No data
Right 992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG No data
992170147_992170150 5 Left 992170147 5:74093327-74093349 CCCTGGGTAAAGAATGGAGGTTT No data
Right 992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992170150 Original CRISPR CTTTCTCTGCTGCAGCTGCT GGG Intergenic
No off target data available for this crispr