ID: 992171317

View in Genome Browser
Species Human (GRCh38)
Location 5:74104808-74104830
Sequence ATTACTTACATATTAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992171317_992171321 30 Left 992171317 5:74104808-74104830 CCATCCATTAATATGTAAGTAAT No data
Right 992171321 5:74104861-74104883 AATTGCAGGCTATGCATTGTTGG No data
992171317_992171319 16 Left 992171317 5:74104808-74104830 CCATCCATTAATATGTAAGTAAT No data
Right 992171319 5:74104847-74104869 ATGCCTTTGCATTTAATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992171317 Original CRISPR ATTACTTACATATTAATGGA TGG (reversed) Intergenic
No off target data available for this crispr