ID: 992173424

View in Genome Browser
Species Human (GRCh38)
Location 5:74126151-74126173
Sequence TCATGAAATTTGAGTGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992173424_992173431 25 Left 992173424 5:74126151-74126173 CCTAGATCACTCAAATTTCATGA No data
Right 992173431 5:74126199-74126221 GGTCTGTAGATTACATTTTGAGG No data
992173424_992173429 3 Left 992173424 5:74126151-74126173 CCTAGATCACTCAAATTTCATGA No data
Right 992173429 5:74126177-74126199 AGTCGGAAGACGGGAATCTTGGG No data
992173424_992173430 4 Left 992173424 5:74126151-74126173 CCTAGATCACTCAAATTTCATGA No data
Right 992173430 5:74126178-74126200 GTCGGAAGACGGGAATCTTGGGG No data
992173424_992173426 -7 Left 992173424 5:74126151-74126173 CCTAGATCACTCAAATTTCATGA No data
Right 992173426 5:74126167-74126189 TTCATGACACAGTCGGAAGACGG No data
992173424_992173427 -6 Left 992173424 5:74126151-74126173 CCTAGATCACTCAAATTTCATGA No data
Right 992173427 5:74126168-74126190 TCATGACACAGTCGGAAGACGGG No data
992173424_992173428 2 Left 992173424 5:74126151-74126173 CCTAGATCACTCAAATTTCATGA No data
Right 992173428 5:74126176-74126198 CAGTCGGAAGACGGGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992173424 Original CRISPR TCATGAAATTTGAGTGATCT AGG (reversed) Intergenic
No off target data available for this crispr