ID: 992174848

View in Genome Browser
Species Human (GRCh38)
Location 5:74139807-74139829
Sequence GGTGCCCCATGGTGTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992174848_992174865 30 Left 992174848 5:74139807-74139829 CCCCCAAGACACCATGGGGCACC No data
Right 992174865 5:74139860-74139882 GTCCCTCGTCAAGGGGCAGAGGG No data
992174848_992174862 22 Left 992174848 5:74139807-74139829 CCCCCAAGACACCATGGGGCACC No data
Right 992174862 5:74139852-74139874 TGTGCTAAGTCCCTCGTCAAGGG No data
992174848_992174864 29 Left 992174848 5:74139807-74139829 CCCCCAAGACACCATGGGGCACC No data
Right 992174864 5:74139859-74139881 AGTCCCTCGTCAAGGGGCAGAGG No data
992174848_992174861 21 Left 992174848 5:74139807-74139829 CCCCCAAGACACCATGGGGCACC No data
Right 992174861 5:74139851-74139873 TTGTGCTAAGTCCCTCGTCAAGG No data
992174848_992174863 23 Left 992174848 5:74139807-74139829 CCCCCAAGACACCATGGGGCACC No data
Right 992174863 5:74139853-74139875 GTGCTAAGTCCCTCGTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992174848 Original CRISPR GGTGCCCCATGGTGTCTTGG GGG (reversed) Intergenic
No off target data available for this crispr