ID: 992176066

View in Genome Browser
Species Human (GRCh38)
Location 5:74149787-74149809
Sequence TTGGTTCACCAGCAGCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992176063_992176066 5 Left 992176063 5:74149759-74149781 CCTGTTGCCTGTACTATGGATGT No data
Right 992176066 5:74149787-74149809 TTGGTTCACCAGCAGCCATTTGG No data
992176064_992176066 -2 Left 992176064 5:74149766-74149788 CCTGTACTATGGATGTAATGATT No data
Right 992176066 5:74149787-74149809 TTGGTTCACCAGCAGCCATTTGG No data
992176062_992176066 8 Left 992176062 5:74149756-74149778 CCTCCTGTTGCCTGTACTATGGA No data
Right 992176066 5:74149787-74149809 TTGGTTCACCAGCAGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992176066 Original CRISPR TTGGTTCACCAGCAGCCATT TGG Intergenic
No off target data available for this crispr