ID: 992186568

View in Genome Browser
Species Human (GRCh38)
Location 5:74250249-74250271
Sequence AGCACCCTTGTGTCTCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992186568_992186572 13 Left 992186568 5:74250249-74250271 CCATGGGGAGACACAAGGGTGCT No data
Right 992186572 5:74250285-74250307 AAGCTGTACAGAAGAAGAGTGGG No data
992186568_992186576 28 Left 992186568 5:74250249-74250271 CCATGGGGAGACACAAGGGTGCT No data
Right 992186576 5:74250300-74250322 AGAGTGGGCACCACCAATGGGGG No data
992186568_992186575 27 Left 992186568 5:74250249-74250271 CCATGGGGAGACACAAGGGTGCT No data
Right 992186575 5:74250299-74250321 AAGAGTGGGCACCACCAATGGGG No data
992186568_992186573 25 Left 992186568 5:74250249-74250271 CCATGGGGAGACACAAGGGTGCT No data
Right 992186573 5:74250297-74250319 AGAAGAGTGGGCACCACCAATGG No data
992186568_992186574 26 Left 992186568 5:74250249-74250271 CCATGGGGAGACACAAGGGTGCT No data
Right 992186574 5:74250298-74250320 GAAGAGTGGGCACCACCAATGGG No data
992186568_992186571 12 Left 992186568 5:74250249-74250271 CCATGGGGAGACACAAGGGTGCT No data
Right 992186571 5:74250284-74250306 AAAGCTGTACAGAAGAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992186568 Original CRISPR AGCACCCTTGTGTCTCCCCA TGG (reversed) Intergenic
No off target data available for this crispr