ID: 992186619

View in Genome Browser
Species Human (GRCh38)
Location 5:74250534-74250556
Sequence GAGGAGATATTCCTGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992186619_992186622 -6 Left 992186619 5:74250534-74250556 CCAGCTCCCAGGAATATCTCCTC No data
Right 992186622 5:74250551-74250573 CTCCTCACCAACTTCCCTAGTGG No data
992186619_992186623 -5 Left 992186619 5:74250534-74250556 CCAGCTCCCAGGAATATCTCCTC No data
Right 992186623 5:74250552-74250574 TCCTCACCAACTTCCCTAGTGGG No data
992186619_992186629 29 Left 992186619 5:74250534-74250556 CCAGCTCCCAGGAATATCTCCTC No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186619_992186628 28 Left 992186619 5:74250534-74250556 CCAGCTCCCAGGAATATCTCCTC No data
Right 992186628 5:74250585-74250607 TTTCTGTCTGCGTATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992186619 Original CRISPR GAGGAGATATTCCTGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr