ID: 992186625

View in Genome Browser
Species Human (GRCh38)
Location 5:74250558-74250580
Sequence TAGTGTCCCACTAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992186625_992186629 5 Left 992186625 5:74250558-74250580 CCAACTTCCCTAGTGGGACACTA No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186625_992186628 4 Left 992186625 5:74250558-74250580 CCAACTTCCCTAGTGGGACACTA No data
Right 992186628 5:74250585-74250607 TTTCTGTCTGCGTATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992186625 Original CRISPR TAGTGTCCCACTAGGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr