ID: 992186626

View in Genome Browser
Species Human (GRCh38)
Location 5:74250565-74250587
Sequence AAACAGATAGTGTCCCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992186626_992186629 -2 Left 992186626 5:74250565-74250587 CCCTAGTGGGACACTATCTGTTT No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186626_992186628 -3 Left 992186626 5:74250565-74250587 CCCTAGTGGGACACTATCTGTTT No data
Right 992186628 5:74250585-74250607 TTTCTGTCTGCGTATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992186626 Original CRISPR AAACAGATAGTGTCCCACTA GGG (reversed) Intergenic
No off target data available for this crispr