ID: 992186629

View in Genome Browser
Species Human (GRCh38)
Location 5:74250586-74250608
Sequence TTCTGTCTGCGTATAAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992186624_992186629 10 Left 992186624 5:74250553-74250575 CCTCACCAACTTCCCTAGTGGGA No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186626_992186629 -2 Left 992186626 5:74250565-74250587 CCCTAGTGGGACACTATCTGTTT No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186621_992186629 22 Left 992186621 5:74250541-74250563 CCAGGAATATCTCCTCACCAACT No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186620_992186629 23 Left 992186620 5:74250540-74250562 CCCAGGAATATCTCCTCACCAAC No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186625_992186629 5 Left 992186625 5:74250558-74250580 CCAACTTCCCTAGTGGGACACTA No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186627_992186629 -3 Left 992186627 5:74250566-74250588 CCTAGTGGGACACTATCTGTTTC No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data
992186619_992186629 29 Left 992186619 5:74250534-74250556 CCAGCTCCCAGGAATATCTCCTC No data
Right 992186629 5:74250586-74250608 TTCTGTCTGCGTATAAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992186629 Original CRISPR TTCTGTCTGCGTATAAAATA GGG Intergenic
No off target data available for this crispr