ID: 992187963

View in Genome Browser
Species Human (GRCh38)
Location 5:74262099-74262121
Sequence TCCAGATGGACTGCACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992187963_992187974 19 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187974 5:74262141-74262163 GGACAGGCTCTGGAGCTGCTGGG No data
992187963_992187971 3 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187971 5:74262125-74262147 TATGGACAGGGGAGGCGGACAGG No data
992187963_992187968 -8 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187968 5:74262114-74262136 CATCTGGAACATATGGACAGGGG No data
992187963_992187969 -5 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187969 5:74262117-74262139 CTGGAACATATGGACAGGGGAGG No data
992187963_992187970 -2 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187970 5:74262120-74262142 GAACATATGGACAGGGGAGGCGG No data
992187963_992187967 -9 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187967 5:74262113-74262135 CCATCTGGAACATATGGACAGGG No data
992187963_992187973 18 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187973 5:74262140-74262162 CGGACAGGCTCTGGAGCTGCTGG No data
992187963_992187965 -10 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187965 5:74262112-74262134 TCCATCTGGAACATATGGACAGG No data
992187963_992187975 20 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187975 5:74262142-74262164 GACAGGCTCTGGAGCTGCTGGGG No data
992187963_992187972 9 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187972 5:74262131-74262153 CAGGGGAGGCGGACAGGCTCTGG No data
992187963_992187976 27 Left 992187963 5:74262099-74262121 CCAGCATGTGCAGTCCATCTGGA No data
Right 992187976 5:74262149-74262171 TCTGGAGCTGCTGGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992187963 Original CRISPR TCCAGATGGACTGCACATGC TGG (reversed) Intergenic
No off target data available for this crispr