ID: 992189382

View in Genome Browser
Species Human (GRCh38)
Location 5:74276240-74276262
Sequence GGCTTCTGGTGGTCTGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992189382_992189391 17 Left 992189382 5:74276240-74276262 CCTGATGCAGACCACCAGAAGCC No data
Right 992189391 5:74276280-74276302 AGTGAAGGCTGCACAGCTGCTGG No data
992189382_992189397 29 Left 992189382 5:74276240-74276262 CCTGATGCAGACCACCAGAAGCC No data
Right 992189397 5:74276292-74276314 ACAGCTGCTGGGGGTGACAGGGG No data
992189382_992189395 27 Left 992189382 5:74276240-74276262 CCTGATGCAGACCACCAGAAGCC No data
Right 992189395 5:74276290-74276312 GCACAGCTGCTGGGGGTGACAGG No data
992189382_992189396 28 Left 992189382 5:74276240-74276262 CCTGATGCAGACCACCAGAAGCC No data
Right 992189396 5:74276291-74276313 CACAGCTGCTGGGGGTGACAGGG No data
992189382_992189390 2 Left 992189382 5:74276240-74276262 CCTGATGCAGACCACCAGAAGCC No data
Right 992189390 5:74276265-74276287 TGCTGCTGGGTAAACAGTGAAGG No data
992189382_992189394 20 Left 992189382 5:74276240-74276262 CCTGATGCAGACCACCAGAAGCC No data
Right 992189394 5:74276283-74276305 GAAGGCTGCACAGCTGCTGGGGG No data
992189382_992189393 19 Left 992189382 5:74276240-74276262 CCTGATGCAGACCACCAGAAGCC No data
Right 992189393 5:74276282-74276304 TGAAGGCTGCACAGCTGCTGGGG No data
992189382_992189392 18 Left 992189382 5:74276240-74276262 CCTGATGCAGACCACCAGAAGCC No data
Right 992189392 5:74276281-74276303 GTGAAGGCTGCACAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992189382 Original CRISPR GGCTTCTGGTGGTCTGCATC AGG (reversed) Intergenic
No off target data available for this crispr