ID: 992194212

View in Genome Browser
Species Human (GRCh38)
Location 5:74323985-74324007
Sequence GTGGACTGCAGTACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992194212_992194218 6 Left 992194212 5:74323985-74324007 CCTTCCTCTGTACTGCAGTCCAC No data
Right 992194218 5:74324014-74324036 GAGGAAGGCTAGAATATAGGAGG No data
992194212_992194215 -9 Left 992194212 5:74323985-74324007 CCTTCCTCTGTACTGCAGTCCAC No data
Right 992194215 5:74323999-74324021 GCAGTCCACTTGCTAGAGGAAGG No data
992194212_992194217 3 Left 992194212 5:74323985-74324007 CCTTCCTCTGTACTGCAGTCCAC No data
Right 992194217 5:74324011-74324033 CTAGAGGAAGGCTAGAATATAGG No data
992194212_992194219 13 Left 992194212 5:74323985-74324007 CCTTCCTCTGTACTGCAGTCCAC No data
Right 992194219 5:74324021-74324043 GCTAGAATATAGGAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992194212 Original CRISPR GTGGACTGCAGTACAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr