ID: 992197830

View in Genome Browser
Species Human (GRCh38)
Location 5:74357259-74357281
Sequence CCTCAGAAGCAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992197830_992197839 29 Left 992197830 5:74357259-74357281 CCCTCCTCACTCTGCTTCTGAGG No data
Right 992197839 5:74357311-74357333 TATCAGAGGTCAAATAGGGCTGG No data
992197830_992197837 24 Left 992197830 5:74357259-74357281 CCCTCCTCACTCTGCTTCTGAGG No data
Right 992197837 5:74357306-74357328 CTCTTTATCAGAGGTCAAATAGG No data
992197830_992197836 15 Left 992197830 5:74357259-74357281 CCCTCCTCACTCTGCTTCTGAGG No data
Right 992197836 5:74357297-74357319 CAAACAACACTCTTTATCAGAGG No data
992197830_992197838 25 Left 992197830 5:74357259-74357281 CCCTCCTCACTCTGCTTCTGAGG No data
Right 992197838 5:74357307-74357329 TCTTTATCAGAGGTCAAATAGGG No data
992197830_992197840 30 Left 992197830 5:74357259-74357281 CCCTCCTCACTCTGCTTCTGAGG No data
Right 992197840 5:74357312-74357334 ATCAGAGGTCAAATAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992197830 Original CRISPR CCTCAGAAGCAGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr