ID: 992199191

View in Genome Browser
Species Human (GRCh38)
Location 5:74367495-74367517
Sequence ACATCCTTGGGAATTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992199191_992199194 -3 Left 992199191 5:74367495-74367517 CCAGGACAAATTCCCAAGGATGT No data
Right 992199194 5:74367515-74367537 TGTTGCATTATCCGCCTGTCTGG No data
992199191_992199198 12 Left 992199191 5:74367495-74367517 CCAGGACAAATTCCCAAGGATGT No data
Right 992199198 5:74367530-74367552 CTGTCTGGACAAAGTCTGGCAGG No data
992199191_992199196 8 Left 992199191 5:74367495-74367517 CCAGGACAAATTCCCAAGGATGT No data
Right 992199196 5:74367526-74367548 CCGCCTGTCTGGACAAAGTCTGG No data
992199191_992199199 30 Left 992199191 5:74367495-74367517 CCAGGACAAATTCCCAAGGATGT No data
Right 992199199 5:74367548-74367570 GCAGGAAGAAAACCTTTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992199191 Original CRISPR ACATCCTTGGGAATTTGTCC TGG (reversed) Intergenic