ID: 992202438

View in Genome Browser
Species Human (GRCh38)
Location 5:74397663-74397685
Sequence CCTTATAAGAAGAGGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992202438_992202442 -3 Left 992202438 5:74397663-74397685 CCAAATTCCCTCTTCTTATAAGG No data
Right 992202442 5:74397683-74397705 AGGATATCAGTTATACAGACTGG No data
992202438_992202443 -2 Left 992202438 5:74397663-74397685 CCAAATTCCCTCTTCTTATAAGG No data
Right 992202443 5:74397684-74397706 GGATATCAGTTATACAGACTGGG No data
992202438_992202444 -1 Left 992202438 5:74397663-74397685 CCAAATTCCCTCTTCTTATAAGG No data
Right 992202444 5:74397685-74397707 GATATCAGTTATACAGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992202438 Original CRISPR CCTTATAAGAAGAGGGAATT TGG (reversed) Intergenic
No off target data available for this crispr