ID: 992208733

View in Genome Browser
Species Human (GRCh38)
Location 5:74456416-74456438
Sequence TAGCCACACCTGCTTCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992208732_992208733 16 Left 992208732 5:74456377-74456399 CCAGGGTAGGAATGTGTGTAGTT No data
Right 992208733 5:74456416-74456438 TAGCCACACCTGCTTCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992208733 Original CRISPR TAGCCACACCTGCTTCTAAC AGG Intergenic
No off target data available for this crispr