ID: 992213774

View in Genome Browser
Species Human (GRCh38)
Location 5:74506198-74506220
Sequence ATGTGGGGTCGATGTATGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992213774_992213779 0 Left 992213774 5:74506198-74506220 CCGCTCATACATCGACCCCACAT No data
Right 992213779 5:74506221-74506243 ACACTCACAGTTCCTCCCCTGGG No data
992213774_992213780 1 Left 992213774 5:74506198-74506220 CCGCTCATACATCGACCCCACAT No data
Right 992213780 5:74506222-74506244 CACTCACAGTTCCTCCCCTGGGG No data
992213774_992213782 3 Left 992213774 5:74506198-74506220 CCGCTCATACATCGACCCCACAT No data
Right 992213782 5:74506224-74506246 CTCACAGTTCCTCCCCTGGGGGG No data
992213774_992213778 -1 Left 992213774 5:74506198-74506220 CCGCTCATACATCGACCCCACAT No data
Right 992213778 5:74506220-74506242 TACACTCACAGTTCCTCCCCTGG No data
992213774_992213787 29 Left 992213774 5:74506198-74506220 CCGCTCATACATCGACCCCACAT No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213774_992213788 30 Left 992213774 5:74506198-74506220 CCGCTCATACATCGACCCCACAT No data
Right 992213788 5:74506251-74506273 GCAAACACATAAAATTCGTAGGG No data
992213774_992213781 2 Left 992213774 5:74506198-74506220 CCGCTCATACATCGACCCCACAT No data
Right 992213781 5:74506223-74506245 ACTCACAGTTCCTCCCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992213774 Original CRISPR ATGTGGGGTCGATGTATGAG CGG (reversed) Intergenic
No off target data available for this crispr