ID: 992213777

View in Genome Browser
Species Human (GRCh38)
Location 5:74506215-74506237
Sequence GGAGGAACTGTGAGTGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992213777_992213787 12 Left 992213777 5:74506215-74506237 CCACATACACTCACAGTTCCTCC No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213777_992213789 20 Left 992213777 5:74506215-74506237 CCACATACACTCACAGTTCCTCC No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data
992213777_992213788 13 Left 992213777 5:74506215-74506237 CCACATACACTCACAGTTCCTCC No data
Right 992213788 5:74506251-74506273 GCAAACACATAAAATTCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992213777 Original CRISPR GGAGGAACTGTGAGTGTATG TGG (reversed) Intergenic
No off target data available for this crispr