ID: 992213784

View in Genome Browser
Species Human (GRCh38)
Location 5:74506236-74506258
Sequence GTGTTTGCTCAGCCCCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992213784_992213787 -9 Left 992213784 5:74506236-74506258 CCCCTGGGGGGCTGAGCAAACAC No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213784_992213789 -1 Left 992213784 5:74506236-74506258 CCCCTGGGGGGCTGAGCAAACAC No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data
992213784_992213788 -8 Left 992213784 5:74506236-74506258 CCCCTGGGGGGCTGAGCAAACAC No data
Right 992213788 5:74506251-74506273 GCAAACACATAAAATTCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992213784 Original CRISPR GTGTTTGCTCAGCCCCCCAG GGG (reversed) Intergenic
No off target data available for this crispr