ID: 992213786

View in Genome Browser
Species Human (GRCh38)
Location 5:74506238-74506260
Sequence ATGTGTTTGCTCAGCCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992213786_992213788 -10 Left 992213786 5:74506238-74506260 CCTGGGGGGCTGAGCAAACACAT No data
Right 992213788 5:74506251-74506273 GCAAACACATAAAATTCGTAGGG No data
992213786_992213789 -3 Left 992213786 5:74506238-74506260 CCTGGGGGGCTGAGCAAACACAT No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992213786 Original CRISPR ATGTGTTTGCTCAGCCCCCC AGG (reversed) Intergenic
No off target data available for this crispr