ID: 992213787

View in Genome Browser
Species Human (GRCh38)
Location 5:74506250-74506272
Sequence AGCAAACACATAAAATTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992213783_992213787 -6 Left 992213783 5:74506233-74506255 CCTCCCCTGGGGGGCTGAGCAAA No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213776_992213787 13 Left 992213776 5:74506214-74506236 CCCACATACACTCACAGTTCCTC No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213785_992213787 -10 Left 992213785 5:74506237-74506259 CCCTGGGGGGCTGAGCAAACACA No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213777_992213787 12 Left 992213777 5:74506215-74506237 CCACATACACTCACAGTTCCTCC No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213775_992213787 14 Left 992213775 5:74506213-74506235 CCCCACATACACTCACAGTTCCT No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213774_992213787 29 Left 992213774 5:74506198-74506220 CCGCTCATACATCGACCCCACAT No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213773_992213787 30 Left 992213773 5:74506197-74506219 CCCGCTCATACATCGACCCCACA No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data
992213784_992213787 -9 Left 992213784 5:74506236-74506258 CCCCTGGGGGGCTGAGCAAACAC No data
Right 992213787 5:74506250-74506272 AGCAAACACATAAAATTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992213787 Original CRISPR AGCAAACACATAAAATTCGT AGG Intergenic
No off target data available for this crispr