ID: 992213789

View in Genome Browser
Species Human (GRCh38)
Location 5:74506258-74506280
Sequence CATAAAATTCGTAGGGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992213785_992213789 -2 Left 992213785 5:74506237-74506259 CCCTGGGGGGCTGAGCAAACACA No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data
992213784_992213789 -1 Left 992213784 5:74506236-74506258 CCCCTGGGGGGCTGAGCAAACAC No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data
992213776_992213789 21 Left 992213776 5:74506214-74506236 CCCACATACACTCACAGTTCCTC No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data
992213775_992213789 22 Left 992213775 5:74506213-74506235 CCCCACATACACTCACAGTTCCT No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data
992213783_992213789 2 Left 992213783 5:74506233-74506255 CCTCCCCTGGGGGGCTGAGCAAA No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data
992213777_992213789 20 Left 992213777 5:74506215-74506237 CCACATACACTCACAGTTCCTCC No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data
992213786_992213789 -3 Left 992213786 5:74506238-74506260 CCTGGGGGGCTGAGCAAACACAT No data
Right 992213789 5:74506258-74506280 CATAAAATTCGTAGGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992213789 Original CRISPR CATAAAATTCGTAGGGCCTG TGG Intergenic
No off target data available for this crispr