ID: 992214391

View in Genome Browser
Species Human (GRCh38)
Location 5:74511076-74511098
Sequence TCCTATTAGGTGCCAATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992214388_992214391 -1 Left 992214388 5:74511054-74511076 CCATAGTGGGTATAATGGATGTT No data
Right 992214391 5:74511076-74511098 TCCTATTAGGTGCCAATTTAGGG No data
992214387_992214391 0 Left 992214387 5:74511053-74511075 CCCATAGTGGGTATAATGGATGT No data
Right 992214391 5:74511076-74511098 TCCTATTAGGTGCCAATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992214391 Original CRISPR TCCTATTAGGTGCCAATTTA GGG Intergenic
No off target data available for this crispr