ID: 992217533

View in Genome Browser
Species Human (GRCh38)
Location 5:74540690-74540712
Sequence GATGGAGTCAAGAGAACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992217531_992217533 23 Left 992217531 5:74540644-74540666 CCACTGGAGGACACTAGCAAGAA No data
Right 992217533 5:74540690-74540712 GATGGAGTCAAGAGAACCTCTGG No data
992217528_992217533 28 Left 992217528 5:74540639-74540661 CCCCTCCACTGGAGGACACTAGC No data
Right 992217533 5:74540690-74540712 GATGGAGTCAAGAGAACCTCTGG No data
992217530_992217533 26 Left 992217530 5:74540641-74540663 CCTCCACTGGAGGACACTAGCAA No data
Right 992217533 5:74540690-74540712 GATGGAGTCAAGAGAACCTCTGG No data
992217529_992217533 27 Left 992217529 5:74540640-74540662 CCCTCCACTGGAGGACACTAGCA No data
Right 992217533 5:74540690-74540712 GATGGAGTCAAGAGAACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992217533 Original CRISPR GATGGAGTCAAGAGAACCTC TGG Intergenic
No off target data available for this crispr