ID: 992220036

View in Genome Browser
Species Human (GRCh38)
Location 5:74562754-74562776
Sequence GAGGATGCAGAACCAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992220036_992220038 19 Left 992220036 5:74562754-74562776 CCTTGATCTGGTTCTGCATCCTC No data
Right 992220038 5:74562796-74562818 GCCTATAAAATGTGATAATAAGG No data
992220036_992220040 26 Left 992220036 5:74562754-74562776 CCTTGATCTGGTTCTGCATCCTC No data
Right 992220040 5:74562803-74562825 AAATGTGATAATAAGGTTGCTGG No data
992220036_992220041 27 Left 992220036 5:74562754-74562776 CCTTGATCTGGTTCTGCATCCTC No data
Right 992220041 5:74562804-74562826 AATGTGATAATAAGGTTGCTGGG No data
992220036_992220042 30 Left 992220036 5:74562754-74562776 CCTTGATCTGGTTCTGCATCCTC No data
Right 992220042 5:74562807-74562829 GTGATAATAAGGTTGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992220036 Original CRISPR GAGGATGCAGAACCAGATCA AGG (reversed) Intergenic
No off target data available for this crispr