ID: 992229289

View in Genome Browser
Species Human (GRCh38)
Location 5:74647987-74648009
Sequence CTTTCAACTCTGAAAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992229285_992229289 15 Left 992229285 5:74647949-74647971 CCATCAGTGTACTTGTATTTGCA 0: 1
1: 0
2: 3
3: 23
4: 259
Right 992229289 5:74647987-74648009 CTTTCAACTCTGAAAGACAGAGG No data
992229284_992229289 19 Left 992229284 5:74647945-74647967 CCTGCCATCAGTGTACTTGTATT 0: 1
1: 0
2: 0
3: 25
4: 253
Right 992229289 5:74647987-74648009 CTTTCAACTCTGAAAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992229289 Original CRISPR CTTTCAACTCTGAAAGACAG AGG Intronic
No off target data available for this crispr