ID: 992229289 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:74647987-74648009 |
| Sequence | CTTTCAACTCTGAAAGACAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 992229285_992229289 | 15 | Left | 992229285 | 5:74647949-74647971 | CCATCAGTGTACTTGTATTTGCA | 0: 1 1: 0 2: 3 3: 23 4: 259 |
||
| Right | 992229289 | 5:74647987-74648009 | CTTTCAACTCTGAAAGACAGAGG | No data | ||||
| 992229284_992229289 | 19 | Left | 992229284 | 5:74647945-74647967 | CCTGCCATCAGTGTACTTGTATT | 0: 1 1: 0 2: 0 3: 25 4: 253 |
||
| Right | 992229289 | 5:74647987-74648009 | CTTTCAACTCTGAAAGACAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 992229289 | Original CRISPR | CTTTCAACTCTGAAAGACAG AGG | Intronic | ||
| No off target data available for this crispr | |||||