ID: 992243157

View in Genome Browser
Species Human (GRCh38)
Location 5:74791306-74791328
Sequence CAGGAATCCAGGGGTAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992243152_992243157 -7 Left 992243152 5:74791290-74791312 CCAGGATTCACAGGTCCAGGAAT 0: 80
1: 139
2: 228
3: 219
4: 287
Right 992243157 5:74791306-74791328 CAGGAATCCAGGGGTAAAAGTGG No data
992243149_992243157 0 Left 992243149 5:74791283-74791305 CCCATAGCCAGGATTCACAGGTC 0: 74
1: 155
2: 190
3: 193
4: 242
Right 992243157 5:74791306-74791328 CAGGAATCCAGGGGTAAAAGTGG No data
992243150_992243157 -1 Left 992243150 5:74791284-74791306 CCATAGCCAGGATTCACAGGTCC 0: 71
1: 149
2: 185
3: 171
4: 249
Right 992243157 5:74791306-74791328 CAGGAATCCAGGGGTAAAAGTGG No data
992243146_992243157 21 Left 992243146 5:74791262-74791284 CCAGTATATGGTACTGTTTCTCC 0: 11
1: 164
2: 227
3: 209
4: 318
Right 992243157 5:74791306-74791328 CAGGAATCCAGGGGTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992243157 Original CRISPR CAGGAATCCAGGGGTAAAAG TGG Intronic
No off target data available for this crispr