ID: 992243791

View in Genome Browser
Species Human (GRCh38)
Location 5:74796728-74796750
Sequence TCATTTATACTGAAGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992243788_992243791 3 Left 992243788 5:74796702-74796724 CCTGAATCTTTTTTTTTTTTTTA 0: 4
1: 120
2: 1578
3: 10176
4: 45413
Right 992243791 5:74796728-74796750 TCATTTATACTGAAGGACCATGG No data
992243786_992243791 8 Left 992243786 5:74796697-74796719 CCCAGCCTGAATCTTTTTTTTTT 0: 2
1: 23
2: 216
3: 1629
4: 10623
Right 992243791 5:74796728-74796750 TCATTTATACTGAAGGACCATGG No data
992243785_992243791 16 Left 992243785 5:74796689-74796711 CCACAGCGCCCAGCCTGAATCTT 0: 1
1: 7
2: 100
3: 905
4: 5360
Right 992243791 5:74796728-74796750 TCATTTATACTGAAGGACCATGG No data
992243787_992243791 7 Left 992243787 5:74796698-74796720 CCAGCCTGAATCTTTTTTTTTTT 0: 2
1: 29
2: 381
3: 2893
4: 22018
Right 992243791 5:74796728-74796750 TCATTTATACTGAAGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992243791 Original CRISPR TCATTTATACTGAAGGACCA TGG Intronic
No off target data available for this crispr