ID: 992249725

View in Genome Browser
Species Human (GRCh38)
Location 5:74865677-74865699
Sequence GAAGGCGGTCAGAGCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992249721_992249725 -1 Left 992249721 5:74865655-74865677 CCAAAAGTAGTTACAGGTAAAGG 0: 1
1: 0
2: 2
3: 13
4: 167
Right 992249725 5:74865677-74865699 GAAGGCGGTCAGAGCATCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 335
992249719_992249725 30 Left 992249719 5:74865624-74865646 CCAGAGGAGGGAGAATCATACAA 0: 1
1: 0
2: 1
3: 14
4: 212
Right 992249725 5:74865677-74865699 GAAGGCGGTCAGAGCATCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992249725 Original CRISPR GAAGGCGGTCAGAGCATCTC TGG Intronic
900124646 1:1064040-1064062 AAAGGCGAGCAGAGCAGCTCTGG + Intergenic
901135001 1:6987395-6987417 CAAGGCGGGCAGATCACCTCAGG - Intronic
901419334 1:9139837-9139859 GAAGGCAGGCAGATCATCTGAGG + Intergenic
902308339 1:15560982-15561004 AAATGGGGTCAGAGCATCCCAGG - Intronic
902469182 1:16636702-16636724 CAAGGCGGGCAGATCATCTGAGG - Intergenic
903041295 1:20532740-20532762 CAAGGCGGGCAGATCATCTGAGG + Intergenic
903349508 1:22709838-22709860 GAAGGCTGTCAGAGCAGGGCAGG + Intergenic
904029868 1:27527457-27527479 GTAGGGGGTCAGGGCAGCTCCGG + Intergenic
904217074 1:28929764-28929786 CAAGGCGGGCAGATCATCTGAGG - Intronic
905053318 1:35071904-35071926 TAAGGCGGGCAGATCATCTGAGG + Intronic
905341207 1:37278882-37278904 GTAGGCTGTCAGAGCATGACAGG + Intergenic
905807158 1:40885163-40885185 CAAGGCGGTCAGATCACCTGAGG + Intergenic
905817065 1:40959705-40959727 CAAGGCGGGCAGATCATCTGAGG - Intergenic
905852157 1:41282501-41282523 CAAGGCGGGCAGATCACCTCAGG - Intergenic
906437258 1:45806807-45806829 CAAGGCGGGCAGATCATCTGAGG - Intronic
906610162 1:47196135-47196157 GGAGGCGGGCAGATCATCTGAGG + Intergenic
907194355 1:52674570-52674592 GAAGGCAGGCAGATCATCTGAGG - Intergenic
907993679 1:59607881-59607903 GAAGGTGGTCAGAGCGTTACTGG + Exonic
910442604 1:87267853-87267875 GATGGAGGTGAGAGCATCTCAGG - Intergenic
911532981 1:99067906-99067928 CAAGGCGGCCAGATCACCTCAGG - Intergenic
912429220 1:109620383-109620405 GAAGGCGGTCAGCTCCTCCCAGG + Intronic
912788168 1:112624374-112624396 CAAGGCGGTCAGATCATCTGAGG + Intronic
912821908 1:112874541-112874563 CAAGGCGGGCAGATCATCTGAGG + Intergenic
913134750 1:115877582-115877604 GAAGCCGGTCAGAGATTCTCTGG - Intergenic
913313828 1:117533158-117533180 GAAGGGGATGAGAGCAGCTCTGG + Intergenic
915224292 1:154401331-154401353 CAAGGCGGGCAGATCATCTGAGG - Intergenic
916311334 1:163401951-163401973 GGAGGCGGGCAGATCATCTGAGG - Intergenic
916765841 1:167859791-167859813 GAAGCTGGTAAGAGCATCTGTGG - Exonic
918833451 1:189429063-189429085 CAAGGCGGGCAGATCATCTGAGG - Intergenic
919685300 1:200478779-200478801 CAAGGCGGGCAGATCATCTGAGG + Intergenic
919714026 1:200756218-200756240 CAAGGCGGGCAGATCATCTGAGG + Intronic
919831415 1:201542868-201542890 GAAAGCTTTCAGAGCATCTGAGG - Intergenic
920211235 1:204330229-204330251 CAAGGCGGGCAGATCATCTGAGG - Intronic
921131205 1:212221588-212221610 GAAGCAGGTAACAGCATCTCAGG - Intergenic
921637549 1:217514057-217514079 CAAGGCGGGCAGATCATCTGAGG - Intronic
922193005 1:223336184-223336206 CAAGGCGGGCAGATCATCTGAGG - Intronic
1063077928 10:2734962-2734984 GAAGGCTGTCTGAGGATGTCTGG - Intergenic
1063098234 10:2926903-2926925 GAGGGCGGTGAGGGCATTTCTGG + Intergenic
1065114783 10:22474909-22474931 GAAGGCTGTGACAGCTTCTCTGG - Intergenic
1065923448 10:30413801-30413823 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1065979700 10:30880196-30880218 CAAGGCGGGCAGATCACCTCAGG + Intronic
1067000412 10:42606230-42606252 CAAGGCGGGCAGATCATCTGTGG + Intronic
1073166723 10:101461132-101461154 CAAGGCGGGCAGATCATCTGAGG - Intronic
1073233491 10:101993036-101993058 CAAGGCGGGCAGATCATCTGAGG + Intronic
1073341722 10:102750012-102750034 CAAGGCGGGCAGATCATCTGAGG - Intronic
1076492744 10:130874188-130874210 GAATGGGGTGACAGCATCTCAGG - Intergenic
1077216254 11:1396355-1396377 GGAGCCGGTCCGAGCAACTCTGG - Intronic
1077776006 11:5272266-5272288 CAAGGCGGGCAGATCATCTGAGG + Intronic
1078776289 11:14396743-14396765 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1078840611 11:15073268-15073290 CAAGGAGGTGAGAGCAGCTCTGG + Intronic
1080845843 11:36026010-36026032 CAAGGCGGGCAGATCATCTAAGG - Intronic
1081900509 11:46623658-46623680 CAAGGCGGGCAGATCATCTGAGG - Intronic
1082825279 11:57573113-57573135 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1085394268 11:76198899-76198921 CAAGGCGGGCAGATCATCTGAGG + Intronic
1088295920 11:108294505-108294527 TAAGGCGGGCAGATCATCTGAGG + Intronic
1088440707 11:109867233-109867255 GAAGGCTGTGAGAGCAGCCCAGG + Intergenic
1088648081 11:111933358-111933380 GAAGGCGGGCAGATCACCTGAGG - Intronic
1088808104 11:113370078-113370100 GATGGGGTTCAGAGCAACTCAGG + Intronic
1089067944 11:115676275-115676297 GAAGCTGGGCAGTGCATCTCAGG - Intergenic
1089450786 11:118594780-118594802 CAAGGCGGGCAGATCATCTAAGG - Intronic
1089991044 11:122860280-122860302 GAAGGCGGGCAGATCACCTGAGG - Intronic
1090407524 11:126486032-126486054 AAAGAGGGTCTGAGCATCTCAGG + Intronic
1090663824 11:128901813-128901835 GAAGGCGGACGAGGCATCTCAGG - Exonic
1091381029 12:59883-59905 CAAGGCGGGCAGATCACCTCAGG + Intergenic
1091765654 12:3118491-3118513 CAAGGCGGTCGGATCATCTGAGG - Intronic
1092062316 12:5561463-5561485 CAAGGCGGTCAGATCACCTGAGG + Intronic
1092152165 12:6256832-6256854 CAAGGCGGTCAGATCACCTGAGG + Intergenic
1093254184 12:16845258-16845280 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1094704891 12:32904734-32904756 CAAGGCGGGCAGATCACCTCAGG - Intergenic
1095890188 12:47228635-47228657 CAAGGCGGGCAGATCATCTGAGG + Intronic
1096316119 12:50567758-50567780 CAAGGCGGGCAGATCATCTGAGG - Intronic
1096463900 12:51837667-51837689 GAAGGTGGCCTGAGCATCCCAGG - Intergenic
1096991232 12:55805477-55805499 CAAGGCGGGCAGATCATCTGAGG + Intronic
1098445195 12:70559485-70559507 GAAGACAGTAAGTGCATCTCTGG + Exonic
1101921067 12:108933443-108933465 CAAGGCAGTCAGATCATCTGAGG + Intronic
1102126608 12:110487365-110487387 CAAGGCGGGCAGATCATCTGAGG - Intronic
1102896228 12:116600398-116600420 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1103291196 12:119847656-119847678 CAAGGCGGGCAGATCATCTGAGG + Intronic
1103434987 12:120918131-120918153 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1104160302 12:126172953-126172975 CAAGGCGGGCAGATCATGTCAGG + Intergenic
1104879857 12:132063278-132063300 CAAGGCGGGCAGAGCATTTAAGG + Intronic
1105655949 13:22438819-22438841 CAAGGCGGTCAGATCACCTGAGG - Intergenic
1106224219 13:27773070-27773092 GAAGGGTGTGAGAGCATCACTGG + Intergenic
1107509955 13:41073580-41073602 CAAGGCGGGCAGATCATCTGAGG + Intronic
1107540966 13:41388740-41388762 GAACGCTGTGAGAACATCTCCGG + Intergenic
1108639674 13:52371326-52371348 AAAGGCGGGCAGATCATCTGAGG - Intergenic
1108649252 13:52459553-52459575 GAAGGTGGGCAGATCACCTCAGG - Intronic
1110214148 13:73007575-73007597 CAAGGCGGGCAGATCACCTCAGG + Intronic
1110536079 13:76652293-76652315 TAAGGCGGGCAGATCACCTCAGG - Intergenic
1112405022 13:99111829-99111851 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1113180710 13:107622194-107622216 CAAGGCGGGCAGATCATCTAAGG + Intronic
1114445583 14:22785493-22785515 CAAGGCGGGCAGATCATCTGAGG + Intronic
1115197369 14:30816185-30816207 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1115995751 14:39194159-39194181 CAAGGCGGGCAGATCACCTCAGG + Intergenic
1116820147 14:49620166-49620188 GAAGGGGGTCAAAGAAACTCTGG - Intronic
1119639984 14:76307701-76307723 CCAGGTGGGCAGAGCATCTCTGG + Intergenic
1120489360 14:85156921-85156943 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1122103903 14:99436494-99436516 GAATGCTGTCTGAGCATGTCTGG - Intronic
1122170142 14:99866336-99866358 CAAGGCGGGCAGATCATCTGTGG + Intronic
1122878216 14:104678507-104678529 GAAGGAGTTGAGAGGATCTCTGG - Intergenic
1123699017 15:22900968-22900990 CGAGGCGGGCAGATCATCTCAGG + Intronic
1125390118 15:39183730-39183752 GAAGGGGTTAAGAGCAGCTCTGG - Intergenic
1125618926 15:41041673-41041695 CAAGGCGGGCAGAGCACCTGAGG - Intronic
1126026495 15:44450828-44450850 CAAGGCAGGCAGATCATCTCAGG - Intronic
1126598342 15:50404095-50404117 TGAGGTGGTCAGATCATCTCAGG - Intergenic
1127090873 15:55465796-55465818 CAAGGCGGGCAGATCATCTGAGG - Intronic
1127106627 15:55623333-55623355 CAAGGCGGGCAGATCATCTGAGG + Intronic
1127385677 15:58464738-58464760 CAAGGCGGGCAGATCATCTGAGG + Intronic
1128017824 15:64363185-64363207 CAAGGCGGGCAGATCATCTGAGG - Intronic
1128137224 15:65272839-65272861 GAAGAAGGTCACAGAATCTCAGG + Intronic
1128188242 15:65663439-65663461 CAAGGCGGGCAGATCATCTGAGG - Intronic
1128255121 15:66190657-66190679 GAAGGCTGTCAGGTCACCTCTGG - Intronic
1128517509 15:68351848-68351870 GAAGGCGGGCAGATCAACTGAGG + Intronic
1129790330 15:78336894-78336916 CAGGGAGGTCAGAGCATTTCAGG + Intergenic
1131270671 15:90945870-90945892 CAAGGCGGGCAGATCACCTCAGG - Intronic
1132599250 16:766723-766745 GAAGGCGGTCAGGGTGTCTAGGG - Exonic
1133710399 16:8395750-8395772 GAAGGCTGTCACAGCATCTCTGG - Intergenic
1134440005 16:14293823-14293845 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1134746321 16:16591792-16591814 CAAGGCGGTCAGATCACCTGAGG - Intergenic
1134999160 16:18761908-18761930 CAAGGCGGTCAGATCACCTGAGG + Intergenic
1136452619 16:30362215-30362237 CAAGGCGGGCAGATCATCTGAGG - Intronic
1137361722 16:47823319-47823341 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1137606014 16:49787382-49787404 GAGGGAGGGCAGAGCATCCCTGG - Intronic
1138907584 16:61356091-61356113 TAAGGCGGGCAGATCATCTGAGG + Intergenic
1140461486 16:75143476-75143498 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1140479657 16:75255757-75255779 CAAGGCGGGCAGATCATCTGAGG + Intronic
1140888629 16:79266437-79266459 AAAGGCAATAAGAGCATCTCTGG + Intergenic
1141163288 16:81643555-81643577 CAAGGCGGGCAGATCATCTGAGG + Intronic
1141180528 16:81750173-81750195 CAAGGCGGACAGATCACCTCAGG + Intronic
1144788844 17:17846471-17846493 GAAGGCAGGCAGAGCAGCTAGGG - Intronic
1145947902 17:28791890-28791912 GAAGGCGGGCAGATCACCTGAGG - Intronic
1148321326 17:46756263-46756285 GACAGCTGTCAGAGGATCTCTGG - Exonic
1150033917 17:61772584-61772606 CAAGGCGGGCAGATCATCTGAGG + Intronic
1150436367 17:65157387-65157409 GAAGGGGCTCAGAGCTTCTGTGG + Intronic
1150743432 17:67797806-67797828 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1151129981 17:71886522-71886544 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1151585596 17:75006576-75006598 GAGGGTGGTCAGGGCACCTCTGG + Intergenic
1151613887 17:75195386-75195408 CAAGGTGGTCAGATCATCTGAGG + Intergenic
1151615553 17:75207990-75208012 TAAGGCGGGCAGATCATCTGAGG - Intronic
1152058859 17:78053395-78053417 CAAGGCGGGCAGATCATCTGAGG + Intronic
1152697868 17:81805469-81805491 GAAGGCGGGCAGGGCACCTCGGG + Intronic
1153284261 18:3443763-3443785 CAAGGCGGGCAGATCATCTGAGG - Intronic
1155543774 18:26893080-26893102 CAAGGCGGGCAGAGCACCTGAGG - Intergenic
1157672456 18:49541858-49541880 CAAGGCGGTCAGATCACCTGAGG - Intergenic
1158592209 18:58787350-58787372 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1160788688 19:913009-913031 GGAGGCGGGGAGAGGATCTCAGG + Intronic
1161736172 19:5993408-5993430 GCAGGAGCTCAGAGCATCGCTGG - Exonic
1162054992 19:8057250-8057272 CAAGGCGGGCAGATCATCTGAGG - Intronic
1162314603 19:9930610-9930632 CAAGGCGGGCAGATCATCTGAGG + Intronic
1162892761 19:13746017-13746039 CAAGGCGGGCAGATCATCTGAGG + Intronic
1163161299 19:15465774-15465796 CAAGGCGGGCAGATCATTTCAGG - Intergenic
1163235819 19:16029834-16029856 GAAGGCGGTCAAAGAATCCATGG - Intergenic
1163825076 19:19518974-19518996 CAAGGCGGGCAGATCATCTGAGG - Intronic
1164162745 19:22639476-22639498 CAAGGCGGGCAGATCATCTGAGG + Intronic
1164575048 19:29401019-29401041 GGAGGCCGTGAGAGCCTCTCAGG - Intergenic
1164846915 19:31440043-31440065 GAAAGCAGCCAGGGCATCTCTGG + Intergenic
1165084709 19:33336084-33336106 GAAGGGGGGCAGATCATCTGAGG - Intergenic
1165358647 19:35319789-35319811 CAAGGCGGGCAGATCATCTAAGG + Intronic
1165487048 19:36102491-36102513 CAAGGCGGGCAGATCATCTGAGG - Intronic
1165675766 19:37721238-37721260 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1166545564 19:43632850-43632872 CAAGGCGGGCAGATCACCTCAGG + Intronic
1166830746 19:45638429-45638451 AAAGGCGGTCAAGGCAGCTCAGG - Intronic
1167032030 19:46968852-46968874 CAAGGCAGGCAGATCATCTCAGG + Intronic
1167131735 19:47591169-47591191 CAAGGCGGGCAGATCACCTCAGG - Intergenic
1167617577 19:50543971-50543993 CAAGGCGGGCAGATCATCTGAGG + Intronic
1168368718 19:55813093-55813115 GAAGGCGGGCAGATCACCTGAGG + Intronic
926831509 2:16967541-16967563 GAAGGCAGTTAGAGCATTTTAGG + Intergenic
926981806 2:18580379-18580401 CAAGGCGGGCAGATCATCTGAGG + Intronic
927397418 2:22669881-22669903 GGAGGCTGTCACAGAATCTCTGG - Intergenic
927691815 2:25213865-25213887 GAAGGCAGGCAGATCACCTCAGG + Intergenic
927905949 2:26857127-26857149 CAAGGCTGTCAGGACATCTCTGG - Intronic
928512830 2:32017382-32017404 CAAGGCGGGCAGATCATCTGAGG + Intronic
930140615 2:47948033-47948055 CAAGGCGGGCAGATCATCTGAGG + Intergenic
931294494 2:60908036-60908058 GAAGGCTTTCAGGGCATCTCAGG - Intronic
931325389 2:61216684-61216706 CAAGGCGGGCAGATCATCTGAGG + Intronic
934572000 2:95378500-95378522 CAAGGCGGTCAGATCACCTGAGG + Intronic
936373391 2:111921265-111921287 GAAGGCGGGCAGATCACCTGAGG + Intronic
938029433 2:127980109-127980131 CAAGGCGGGCAGATCATCTGAGG - Intronic
941937481 2:170996229-170996251 CAAGGCGGGCAGATCATCTGAGG - Intronic
946406171 2:219493113-219493135 GTTGGGGGTCAGTGCATCTCAGG + Exonic
946823793 2:223656106-223656128 CAAGGCGGGCAGATCATCTGAGG - Intergenic
946880613 2:224173689-224173711 TAAGGAGGTCAGAGCCTATCTGG - Intergenic
947254210 2:228143736-228143758 TAAGGCGGGCAGATCATCTGAGG - Intronic
1169082357 20:2805221-2805243 GAGGGCGGGAAGGGCATCTCCGG - Intergenic
1169785862 20:9358660-9358682 CAAGGCGGACAGATCATCTGAGG + Intronic
1170697926 20:18676695-18676717 GAAGACAGTCAGGACATCTCTGG - Intronic
1171424258 20:25039759-25039781 GAATGAGGACAGAGCTTCTCTGG - Intronic
1171996607 20:31736500-31736522 CAAGGCGGCCAGATCACCTCAGG - Intergenic
1172285872 20:33740094-33740116 CAAGGCGGGCAGAGCACCTGAGG - Intronic
1173058652 20:39640461-39640483 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1173216438 20:41089256-41089278 CAAGGCGGGCAGATCATCTGAGG - Intronic
1173281561 20:41632879-41632901 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1173449117 20:43146915-43146937 AAAGGAAGACAGAGCATCTCTGG + Intronic
1173803288 20:45908343-45908365 GAAGGAGCTCAGAGCCTATCTGG - Intronic
1175396462 20:58666659-58666681 CAAGGCGGGCAGATCATCTGAGG - Intronic
1180640143 22:17291681-17291703 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1180786993 22:18553016-18553038 GGAGGCGGTGAGAGCAGATCAGG - Intergenic
1181234747 22:21442290-21442312 GGAGGCGGTGAGAGCAGATCAGG + Intronic
1181243903 22:21492541-21492563 GGAGGCGGTGAGAGCAGATCAGG - Intergenic
1181628144 22:24135156-24135178 CAAGGCGGGCAGATCATCTGAGG + Intronic
1182141492 22:27963366-27963388 CAAGGCGGGCAGATCACCTCAGG + Intergenic
1183098980 22:35571738-35571760 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1183280104 22:36927469-36927491 GAGGGCAGTAAGAGCCTCTCTGG + Intronic
1184185369 22:42861294-42861316 CAAGGCGGGCAGATCATCTGAGG + Intronic
1184293717 22:43511114-43511136 GAAGTGGGGCAGAGCCTCTCAGG - Intergenic
949552229 3:5121031-5121053 CAAGGCGGGCAGATCACCTCAGG - Intergenic
949903597 3:8839780-8839802 GAGGGACGCCAGAGCATCTCTGG + Intronic
950211879 3:11129666-11129688 CAAGGCGGGCAGATCATCTGAGG + Intergenic
950811649 3:15654963-15654985 CAAGGCGGGCAGATCATCTGAGG - Intergenic
951620809 3:24600386-24600408 CAAGGTGGTCAGATCACCTCAGG + Intergenic
952267709 3:31802323-31802345 CAAGGCGGACAGATCATCTGAGG + Intronic
954787113 3:53101803-53101825 GAAGGGGGGCAGATCATCTGAGG + Intronic
958665121 3:97127485-97127507 CAAGGCGGGCAGATCATCTGAGG + Intronic
958787268 3:98612055-98612077 CAAGGCGGGCAGATCATCTGAGG + Intergenic
959333921 3:105040156-105040178 AAAGGCAGTCAGTGCCTCTCTGG - Intergenic
960614475 3:119584328-119584350 CAAGGCGGGCAGATCATCTGAGG + Intronic
961612232 3:128149415-128149437 GAAGGCGGGCAGATCACTTCAGG - Intronic
962489409 3:135877765-135877787 CAAGGCGGACAGATCATCTGAGG + Intergenic
963873954 3:150452211-150452233 GAAGGCAGGCAGATCATCTGAGG + Intronic
965434554 3:168632822-168632844 CAAGGCGGGCAGATCATCTGAGG + Intergenic
968862609 4:3184661-3184683 GCAGGAGGTCAGAGCCTGTCTGG + Intronic
970702386 4:18757609-18757631 CAAGGCGGGCAGATCATCTGAGG + Intergenic
973245116 4:48003089-48003111 CAAGGTGGTCAGAGCATCACTGG + Intronic
974109974 4:57513976-57513998 GAAGGCGGAAACAGCAGCTCAGG - Intergenic
975155543 4:71068295-71068317 CAAGGCGGGCAGATCATCTGAGG - Intergenic
979802812 4:124932133-124932155 AAAGGATGTCAGAACATCTCAGG - Intergenic
981386145 4:144132897-144132919 GCAGGCGGTGAGTGCATTTCTGG - Intronic
982001663 4:151026257-151026279 CAAGGCGGGCAGATCATCTGAGG + Intergenic
982582904 4:157201840-157201862 GAAGGCGGTCAGAAATTCCCAGG - Intergenic
982697148 4:158615302-158615324 CAAGGCGGGCAGATCATCTGAGG + Intronic
983554890 4:169051247-169051269 GCAGCTGGTCAGAGTATCTCTGG - Intergenic
983865767 4:172764188-172764210 GAAGGCGGGCGGACCATCTGAGG - Intronic
983994888 4:174169999-174170021 CAAGGCGGGCAGATCATCTGAGG + Intergenic
984666700 4:182436783-182436805 CAAGGCGGGCAGATCATCTGAGG + Intronic
984741579 4:183169078-183169100 CAAGGCGGGCAGATCATCTGCGG - Intronic
984879118 4:184395114-184395136 AAAGGTGGTCAGAGCATGCCGGG + Intronic
985126079 4:186696021-186696043 GAAGGCGGGCGGATCATCTGAGG - Intronic
987717589 5:21592379-21592401 AAAGGCCCTCAGAGCATCTATGG - Intergenic
988669605 5:33366899-33366921 CAAGGCGGGCAGATCATCTGAGG + Intergenic
990080001 5:51900895-51900917 CAAGGCGGGCAGATCATCTGAGG - Intergenic
991290871 5:65032907-65032929 GGTGGCGGTGAGAGCAGCTCAGG - Intergenic
992249725 5:74865677-74865699 GAAGGCGGTCAGAGCATCTCTGG + Intronic
992301538 5:75387099-75387121 CAAGGCGGGCAGATCATCTGAGG - Intronic
993705658 5:91166904-91166926 TAAGGCGGGCAGATCATCTGAGG - Intergenic
995514682 5:112942502-112942524 CAAGGCGGGCAGATCATCTGAGG + Intergenic
996716999 5:126596030-126596052 TGAGGCGGGCAGATCATCTCAGG - Intergenic
997137245 5:131339572-131339594 TAAGGCGGGCAGATCATCTCAGG + Intronic
997399939 5:133594423-133594445 CAAGGCGGTCAGATCACCTGAGG - Intronic
998798209 5:145841052-145841074 GAAGGAGGGCAGAGGAACTCAGG + Intergenic
999995810 5:157091210-157091232 CAAGGCGGGCAGATCATCTGAGG + Intronic
1001645946 5:173282533-173282555 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1002351440 5:178586155-178586177 GAAGACGGTCAGCGCATCCTGGG - Intronic
1002505146 5:179674196-179674218 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1002907514 6:1462793-1462815 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1003088067 6:3077364-3077386 GAAGGCTCTCAGAACCTCTCAGG - Intronic
1004359198 6:14956046-14956068 CAAGGCGGGCAGATCATCTGTGG - Intergenic
1004389245 6:15196275-15196297 CGAGGCGGGCAGAGCATCTGAGG - Intergenic
1004434729 6:15579570-15579592 CAAGGCGGGCAGATCATCTGAGG + Intronic
1004733921 6:18386101-18386123 CAAGGCGGGCAGATCATCTGGGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1005745449 6:28832912-28832934 GGAGGCGGTCAGATCATTTAAGG + Intergenic
1006776560 6:36597336-36597358 CAAGGCGGTCAGATCACCTGGGG - Intronic
1007031512 6:38631894-38631916 TAAGGCGGGCAGATCATCTGAGG + Intronic
1009472043 6:64039035-64039057 CAAGGCGGGCAGATCATCTGAGG - Intronic
1010114460 6:72285963-72285985 CAAGGCGGGCAGATCATCTGAGG + Intronic
1011099073 6:83701678-83701700 CAAGGCGGTCAGATCACCTGAGG - Intronic
1011853961 6:91665223-91665245 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1013057300 6:106595728-106595750 CAAGGCGGGCAGATCACCTCAGG - Intronic
1015396386 6:132739200-132739222 CAAGGCGGTCAGATCACCTGAGG + Intergenic
1016954834 6:149616525-149616547 CAAGGCGGGCAGATCATCTGAGG + Intronic
1017976165 6:159359220-159359242 GAAGGTGGGCAGATCATCTGAGG + Intergenic
1018205007 6:161428964-161428986 GAAGGCTGGCAGACCAGCTCAGG + Intronic
1018870107 6:167776116-167776138 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1019315838 7:386103-386125 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1020184349 7:5947479-5947501 CAAGGCGGGCAGATCATCTGAGG + Intronic
1020298568 7:6777287-6777309 CAAGGCGGGCAGATCATCTGAGG - Intronic
1020412079 7:7903484-7903506 CAAGGCGGTCAGTTCATCTGAGG + Intronic
1020417174 7:7959542-7959564 CAAGGCGGGCAGATCATCTGAGG - Intronic
1021882269 7:25106455-25106477 CAAGGCGGGCAGATCATCTAAGG - Intergenic
1022047285 7:26631942-26631964 GGAGGCTGTCACAGTATCTCGGG + Intergenic
1023143658 7:37127958-37127980 CAAGGCGGGCAGATCATCTGAGG + Intronic
1023828711 7:44027170-44027192 CAAGGCGGTCAGATCACCTGAGG + Intergenic
1024723255 7:52162549-52162571 GAAGATGGGCAGAGCATCACAGG - Intergenic
1025973476 7:66350245-66350267 GAAGGCGGGCAGATCACCTGAGG - Intronic
1026597736 7:71748482-71748504 GAAGGTGGGCAGATCATCTGAGG + Intergenic
1029571809 7:101374821-101374843 CAAGGCGGGCAGATCATCTGAGG + Intronic
1029700520 7:102243793-102243815 CAAGGCGGGCAGATCATCTGAGG + Intronic
1029739007 7:102481430-102481452 CAAGGCGGTCAGATCACCTGAGG + Intergenic
1029757008 7:102580607-102580629 CAAGGCGGTCAGATCACCTGAGG + Exonic
1029774947 7:102679669-102679691 CAAGGCGGTCAGATCACCTGAGG + Intergenic
1030369645 7:108684310-108684332 GGAGGCGGGCAGAACATCTGAGG - Intergenic
1031533058 7:122899747-122899769 GAAGGCGGGCAGATCACCTGAGG - Intergenic
1031689544 7:124770254-124770276 GCAGGAGATCAGACCATCTCAGG + Intergenic
1031739102 7:125405589-125405611 GTAGGAGGTCAGAAGATCTCAGG - Intergenic
1032113768 7:129099881-129099903 CAAGGCAGTCAGATCATCTGAGG - Intergenic
1032247493 7:130225320-130225342 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1032626976 7:133601925-133601947 GAAGGCCTCCAGAACATCTCTGG + Intronic
1032838611 7:135696583-135696605 GAAGGCAGGCAGATCATCTGAGG - Intronic
1033210980 7:139460116-139460138 CAAGGCGGGCAGATCATCTGAGG - Intronic
1034067937 7:148154702-148154724 TAAGGCGGGCAGATCATCTGAGG + Intronic
1034069292 7:148167369-148167391 CAAGGCGGGCAGATCATCTGAGG - Intronic
1034891700 7:154845276-154845298 GAACACGGTCAGAGCAGCTATGG + Intronic
1035770470 8:2142986-2143008 CAAGGCGGGCAGATCATCTGAGG - Intronic
1037384193 8:18319938-18319960 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1041082831 8:54229795-54229817 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1041453149 8:58028941-58028963 GAAGGCCTTCAGAGCAGCACTGG - Intronic
1042127590 8:65554145-65554167 CAAGGCGGGCAGATCACCTCAGG - Intergenic
1049556817 8:143286653-143286675 GAAGGTGGACAGAGCACCACGGG - Intergenic
1049643733 8:143726967-143726989 GCAGGCGGTCGGAGCCGCTCCGG + Exonic
1049949526 9:630667-630689 CAAGGCGGTCAGATCACCTGAGG + Intronic
1052289433 9:26825382-26825404 TAAGGCGGGCAGATCATCTGAGG - Intergenic
1054759064 9:68988681-68988703 CAAGGCGGGCAGATCATCTGAGG - Intronic
1054772968 9:69100219-69100241 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1055092784 9:72379726-72379748 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1055096007 9:72414777-72414799 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1056313261 9:85364213-85364235 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1056508062 9:87276124-87276146 AAAGGCGGGCAGATCATCTGAGG + Intergenic
1056567666 9:87789069-87789091 CAAGGCGGGCGGAGCATCTGAGG - Intergenic
1056757354 9:89390201-89390223 GAATGCTGTCAGAGCAGCACTGG - Intronic
1057092582 9:92272615-92272637 CAAGGCGGTCAGATCACCTGAGG + Intronic
1057187802 9:93066938-93066960 CAAGGCGGTCAGATCACCTGAGG - Intronic
1057393201 9:94656291-94656313 GAAGAGGTTCAGAGCGTCTCTGG + Intergenic
1058021486 9:100094423-100094445 CAAGGCGGGCAGATCACCTCAGG + Intronic
1058468932 9:105257326-105257348 CAAGGCGGGCAGACCATCTGAGG - Intronic
1059277875 9:113110636-113110658 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1059278376 9:113113915-113113937 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1060322456 9:122576465-122576487 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1060973922 9:127754167-127754189 GGAGGCGGTGAGATCATCTCTGG - Intronic
1061029508 9:128071642-128071664 CAAGGCGGGCAGATCATCTGAGG - Intronic
1061621431 9:131813690-131813712 CAAGGCGGGCAGATCACCTCAGG - Intergenic
1185732641 X:2473698-2473720 GAAGGTGGTCTGTGCATTTCCGG - Intronic
1187697442 X:21936531-21936553 CAAGGCGGGCAGATCATCTGAGG - Intergenic
1188191237 X:27173981-27174003 GGAGGCGGTCGGATCATCTGAGG + Intergenic
1190223147 X:48525852-48525874 GAAGGCGGGCAGATCACCTGAGG + Intronic
1190641168 X:52483373-52483395 GGTTGCTGTCAGAGCATCTCAGG - Intergenic
1190646504 X:52529492-52529514 GGTTGCTGTCAGAGCATCTCAGG + Intergenic
1190834107 X:54084594-54084616 CAAGGCGGGCAGATCATCTGAGG + Intronic
1192539257 X:71954539-71954561 GAAACTGGCCAGAGCATCTCTGG + Intergenic
1196418409 X:115498069-115498091 CAAGGCGGGCAGATCATCTGAGG + Intergenic
1196859655 X:120015307-120015329 GAAGACGGTCAGTGCCTGTCTGG - Intergenic
1197192988 X:123669546-123669568 CAAGGCGGGCAGATCATCTGAGG - Intronic
1198079287 X:133223802-133223824 GAAGGCGGGCAGATCATTTGAGG + Intergenic
1198682159 X:139194712-139194734 GGTGGCGGTCAGAGCAGCGCTGG - Intronic
1199079192 X:143557486-143557508 GAAGGCGGGCAGATCACCTGAGG + Intergenic
1199174140 X:144764656-144764678 TAAGGGGGTGAGAGGATCTCTGG + Intergenic