ID: 992249769

View in Genome Browser
Species Human (GRCh38)
Location 5:74865878-74865900
Sequence GGGCATTCCCTCACACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992249766_992249769 0 Left 992249766 5:74865855-74865877 CCGCGGCGGAGGCGAGCGAAGAC 0: 1
1: 0
2: 0
3: 3
4: 32
Right 992249769 5:74865878-74865900 GGGCATTCCCTCACACAAAATGG 0: 1
1: 0
2: 0
3: 9
4: 102
992249765_992249769 1 Left 992249765 5:74865854-74865876 CCCGCGGCGGAGGCGAGCGAAGA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 992249769 5:74865878-74865900 GGGCATTCCCTCACACAAAATGG 0: 1
1: 0
2: 0
3: 9
4: 102
992249760_992249769 18 Left 992249760 5:74865837-74865859 CCGCAGCTGCGAACCGGCCCGCG 0: 1
1: 0
2: 1
3: 4
4: 49
Right 992249769 5:74865878-74865900 GGGCATTCCCTCACACAAAATGG 0: 1
1: 0
2: 0
3: 9
4: 102
992249764_992249769 5 Left 992249764 5:74865850-74865872 CCGGCCCGCGGCGGAGGCGAGCG 0: 1
1: 0
2: 1
3: 16
4: 168
Right 992249769 5:74865878-74865900 GGGCATTCCCTCACACAAAATGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992249769 Original CRISPR GGGCATTCCCTCACACAAAA TGG Intronic
900498845 1:2989845-2989867 AGGGCTTCCCTCTCACAAAAAGG + Intergenic
904222473 1:28983826-28983848 GGGCAGCACCTCACTCAAAAAGG - Intronic
905280994 1:36849392-36849414 GGTCATTCCTCTACACAAAAGGG - Intronic
908165198 1:61450607-61450629 GGACATTCACACACATAAAACGG - Intronic
913007217 1:114646592-114646614 AGACATTCCCTCAAACAAAACGG - Intronic
916553783 1:165875436-165875458 GGGGATTTCCTCACACAGCAAGG + Intronic
918923578 1:190749052-190749074 TAGCATTCCTTCCCACAAAATGG - Intergenic
922461416 1:225816917-225816939 GGGAATTCCCTCCCACACAGAGG + Intronic
923238682 1:232059689-232059711 GTGCATTCCCACATCCAAAATGG + Intergenic
1062980514 10:1718479-1718501 AGGCATGCACACACACAAAAGGG - Intronic
1063771951 10:9213952-9213974 GGACATTCCCTGACACCAAGAGG - Intergenic
1063835708 10:10009388-10009410 GGGCATTCCATGAGAAAAAAGGG - Intergenic
1064193951 10:13230569-13230591 GGGATTCCCCTCACACCAAATGG + Intronic
1068858870 10:61826294-61826316 GGAAATTCCTTCAGACAAAAAGG - Intergenic
1076551992 10:131286429-131286451 GTGCATTACCTTACACAATACGG - Intronic
1076609428 10:131712040-131712062 GGGCATTTCCCCACAAGAAATGG - Intergenic
1084506684 11:69572817-69572839 GTGGATGCCCTCACTCAAAAAGG + Intergenic
1086121842 11:83312613-83312635 GGGCTTTCTCTCACACACATTGG - Intergenic
1094347256 12:29484661-29484683 GGGCTTTTCCTCCCACAAAATGG - Intronic
1094557458 12:31515615-31515637 GTTCATTCCTTCATACAAAATGG - Intronic
1095128271 12:38508045-38508067 GGGCATTGCCTCACCCAGGAAGG + Intergenic
1097807264 12:63979692-63979714 GGACACTGCCTAACACAAAATGG + Intronic
1098239505 12:68452415-68452437 GTGTGTTTCCTCACACAAAAAGG - Intergenic
1099346126 12:81501977-81501999 GGGCATTTTCTCTCAGAAAAAGG + Intronic
1105951031 13:25229699-25229721 GGGGATTCCCTCACACAGGGAGG - Intergenic
1106336663 13:28789440-28789462 GGGCATTGCCTCACCCGGAAAGG - Intergenic
1107156245 13:37170442-37170464 AGGCATCCCCCAACACAAAATGG - Intergenic
1107765504 13:43730077-43730099 GGGCATTCCCTCTCACCCATGGG + Intronic
1112717393 13:102202377-102202399 TCTCATTCCCCCACACAAAAAGG + Intronic
1114777395 14:25499449-25499471 GTGCATTCCCTCAGATACAAGGG + Intergenic
1118079597 14:62343072-62343094 CTGCATTCCCTCACAAAAGATGG - Intergenic
1121406013 14:93719838-93719860 GGGCATACCCTCCCATAAAGGGG - Exonic
1139020342 16:62741232-62741254 GGGCATTCTAGCACACAGAATGG + Intergenic
1143988800 17:10939068-10939090 GGGGTGTCCCTGACACAAAACGG - Intergenic
1145687975 17:26695603-26695625 GGGAATAGCCTCACATAAAAAGG + Intergenic
1145809164 17:27754534-27754556 GGGCAGCCCACCACACAAAAGGG - Intergenic
1146388350 17:32397789-32397811 TGGCCTTCCATCACAAAAAAGGG - Intergenic
1147639998 17:41991047-41991069 GAGCAATCACACACACAAAAAGG + Intronic
1152366195 17:79857919-79857941 GGGAATTCGCTCACACACTATGG + Intergenic
1155347966 18:24877396-24877418 GGGCATTGCCTTACAAACAAAGG - Intergenic
1158164338 18:54521991-54522013 AGGCATTCCTTCACAAGAAATGG + Intergenic
1158585833 18:58733799-58733821 GGGCATTTACTCACACTACAGGG + Intronic
1160352896 18:78200239-78200261 GGGCATTCACACACAGAAATTGG - Intergenic
1160571660 18:79821635-79821657 GGGGATGTGCTCACACAAAAGGG - Intergenic
1161119169 19:2515835-2515857 GGACATTCCATCACCCCAAAAGG - Intronic
1162220666 19:9173561-9173583 GGGCACTCAGTTACACAAAAGGG + Intergenic
1165875986 19:39007260-39007282 GGGCATTCCCTCTGACAGCAAGG - Intronic
1166581956 19:43908948-43908970 GGGCATTGGCTTACACCAAAAGG - Intergenic
931693246 2:64852982-64853004 GGGCATTTCCTCCCACAGACTGG + Intergenic
932420857 2:71600566-71600588 GGGCACCCCCTCCCACAGAATGG - Intronic
935890272 2:107669600-107669622 GAGCAGTCCCTCACATAAAAGGG + Intergenic
936011826 2:108930019-108930041 TGGCATCCCCTCACACAGCAAGG + Intronic
936868665 2:117107665-117107687 GGCCATCACCTCACACAAAAAGG + Intergenic
939398590 2:141662584-141662606 GGGCATTACCTAACAGTAAAGGG + Intronic
944893936 2:204145029-204145051 GGGCATTCTCTCTCAGAAAATGG + Intergenic
946977348 2:225168053-225168075 GGGCAGTCCCTCACAATAAGTGG - Intergenic
948174856 2:235935084-235935106 GGGCATTCCATTTCACGAAATGG - Intronic
948243547 2:236458649-236458671 GGGCATTCGCTGGCAGAAAATGG + Intronic
948410864 2:237759477-237759499 GGGGAGTTCCTCACACACAAGGG + Intronic
948814055 2:240500676-240500698 GGGCATTCCCGCACACTGCAAGG - Intronic
1169722348 20:8692595-8692617 GTGTATTCCCTCACACAGCAAGG + Intronic
1176878261 21:14157341-14157363 GAGCATTTAGTCACACAAAAGGG + Intronic
952906268 3:38140997-38141019 ACACATTCACTCACACAAAAAGG - Intronic
953264206 3:41370526-41370548 GGGCATTGCCTCACCCAGGAAGG + Intronic
954586584 3:51741862-51741884 TGGCATTCCATCAACCAAAAAGG + Intergenic
957424987 3:80025755-80025777 AGGCATTACCCCACACACAATGG - Intergenic
965200762 3:165655315-165655337 GGGCATTGCCTCACCCAGGAAGG + Intergenic
965714282 3:171586232-171586254 GGACATTCCCTCCAAGAAAATGG + Intergenic
968537541 4:1144055-1144077 TGGTATTCCCTAACAAAAAAAGG - Intergenic
969069837 4:4527304-4527326 GGGAATTCACTCACAAAAAAAGG + Intronic
970735276 4:19159593-19159615 TGGCTTTCCCTCAGAGAAAATGG + Intergenic
973904249 4:55510856-55510878 GGGCATTTCCTGAGACAAGATGG + Intronic
979930726 4:126627319-126627341 AGGCATTCCCTCAAATTAAAAGG - Intergenic
986350263 5:6871318-6871340 GTGCATACACTGACACAAAATGG + Intergenic
987098151 5:14567954-14567976 GGGCATTCCCTGAAAGAAAGAGG + Intergenic
988717886 5:33845944-33845966 GGGAACTCACTCCCACAAAATGG + Intronic
988913666 5:35870940-35870962 GGCCATTTACTGACACAAAAAGG + Intronic
992249769 5:74865878-74865900 GGGCATTCCCTCACACAAAATGG + Intronic
993361591 5:86983106-86983128 GGACATACACTCACAGAAAAGGG + Intergenic
997596811 5:135112617-135112639 GGGGATTTCCCCACACATAATGG + Intronic
998962736 5:147506044-147506066 GGTCGTTTCCTCACAGAAAATGG - Intronic
1001358030 5:171050795-171050817 GGGAATTTCTTCAGACAAAAGGG - Intronic
1007327797 6:41074909-41074931 GTGCATTCCCTGGCACATAAAGG + Intronic
1008070941 6:47098297-47098319 TGGCATTCCCTCAAACAACAAGG + Intergenic
1009436153 6:63620728-63620750 GGATTTTCCCTCACACACAAAGG + Intergenic
1009882513 6:69586031-69586053 AGGTATTCCCTGACATAAAATGG - Intergenic
1012454036 6:99384761-99384783 GGGCATTACATCACAATAAAAGG + Intronic
1013486199 6:110598587-110598609 TGGCATTCACTCATGCAAAATGG + Intergenic
1018175169 6:161172296-161172318 GGGTATTCACTCACCCTAAAGGG - Intronic
1020595074 7:10196503-10196525 GAAAATTCACTCACACAAAATGG + Intergenic
1024535837 7:50431706-50431728 AGGCAATGCCTGACACAAAAAGG + Intergenic
1028009974 7:85629807-85629829 GGGCATTTAATAACACAAAAGGG + Intergenic
1032747881 7:134806273-134806295 TCCCATTCCCTCCCACAAAAAGG + Intronic
1039031906 8:33318359-33318381 GCACATTCCCTTGCACAAAAAGG + Intergenic
1039786092 8:40835322-40835344 GCTCATTCCATCACACCAAAGGG + Intronic
1040659786 8:49557671-49557693 GGGACTTCCCCCTCACAAAAAGG - Intergenic
1044314032 8:90728634-90728656 GGGCATTACCTCATAGTAAAGGG + Intronic
1046235353 8:111417159-111417181 GGGAATTGTCTCACACAATATGG + Intergenic
1046688859 8:117259748-117259770 GGGCTTTGACTCACACAGAAAGG - Intergenic
1046730478 8:117720101-117720123 GGGCACTTCTTCACACAAAAAGG + Intergenic
1048091693 8:131248282-131248304 GGGCATTCTATCACACAGAAAGG - Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1056433118 9:86548233-86548255 GGGCATAACCTCAGACAAAGTGG + Intergenic
1059330601 9:113533134-113533156 GGCCATTCCCTTCCATAAAATGG + Intronic
1061107118 9:128539609-128539631 GGGCATTCCCACACACCTAGAGG - Exonic
1062507520 9:136885851-136885873 GAGCATTACCTCACCCCAAAAGG + Intronic
1186202100 X:7165175-7165197 GGACAGTCCATCCCACAAAAGGG - Intergenic
1192406380 X:70890385-70890407 GGGCATCACCTCACCAAAAAGGG + Intronic
1193271373 X:79533486-79533508 GGGAAGTCCATCACAAAAAAAGG - Intergenic
1197277715 X:124499061-124499083 GGGCATGCCTTCCCACAACATGG - Intronic
1199363163 X:146945720-146945742 GGCCATTCCCTCACCCCTAAGGG + Intergenic
1201991643 Y:20033340-20033362 GGCCATTACATAACACAAAAGGG + Intergenic