ID: 992255525

View in Genome Browser
Species Human (GRCh38)
Location 5:74917202-74917224
Sequence TCTCATTGGCAGGAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992255525_992255532 15 Left 992255525 5:74917202-74917224 CCTTCCACTTCCTGCCAATGAGA No data
Right 992255532 5:74917240-74917262 CCCTCACCAAACGCAGCCCCTGG No data
992255525_992255535 22 Left 992255525 5:74917202-74917224 CCTTCCACTTCCTGCCAATGAGA No data
Right 992255535 5:74917247-74917269 CAAACGCAGCCCCTGGATCTTGG No data
992255525_992255529 -8 Left 992255525 5:74917202-74917224 CCTTCCACTTCCTGCCAATGAGA No data
Right 992255529 5:74917217-74917239 CAATGAGATGACCAGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992255525 Original CRISPR TCTCATTGGCAGGAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr