ID: 992259640

View in Genome Browser
Species Human (GRCh38)
Location 5:74956902-74956924
Sequence AGAGCTCTGGCTGGGCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992259635_992259640 -9 Left 992259635 5:74956888-74956910 CCTGTTAGAAATGCAGAGCTCTG No data
Right 992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG No data
992259634_992259640 -3 Left 992259634 5:74956882-74956904 CCGGGACCTGTTAGAAATGCAGA No data
Right 992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG No data
992259633_992259640 -2 Left 992259633 5:74956881-74956903 CCCGGGACCTGTTAGAAATGCAG No data
Right 992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992259640 Original CRISPR AGAGCTCTGGCTGGGCCCGG TGG Intergenic
No off target data available for this crispr