ID: 992260764

View in Genome Browser
Species Human (GRCh38)
Location 5:74967885-74967907
Sequence GTGTCACATTACAAAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992260764_992260765 -7 Left 992260764 5:74967885-74967907 CCAGTGACTTTGTAATGTGACAC No data
Right 992260765 5:74967901-74967923 GTGACACCAGTGCCCCTGAGTGG No data
992260764_992260772 26 Left 992260764 5:74967885-74967907 CCAGTGACTTTGTAATGTGACAC No data
Right 992260772 5:74967934-74967956 GAAGTTTGCTCTTTCTCTCGTGG No data
992260764_992260774 28 Left 992260764 5:74967885-74967907 CCAGTGACTTTGTAATGTGACAC No data
Right 992260774 5:74967936-74967958 AGTTTGCTCTTTCTCTCGTGGGG No data
992260764_992260773 27 Left 992260764 5:74967885-74967907 CCAGTGACTTTGTAATGTGACAC No data
Right 992260773 5:74967935-74967957 AAGTTTGCTCTTTCTCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992260764 Original CRISPR GTGTCACATTACAAAGTCAC TGG (reversed) Intergenic
No off target data available for this crispr