ID: 992262794

View in Genome Browser
Species Human (GRCh38)
Location 5:74987573-74987595
Sequence CCTTCTTTTCTGATGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992262785_992262794 0 Left 992262785 5:74987550-74987572 CCCTCCTGCACTCCTCCCTCACA 0: 1
1: 0
2: 6
3: 98
4: 833
Right 992262794 5:74987573-74987595 CCTTCTTTTCTGATGGCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 239
992262787_992262794 -4 Left 992262787 5:74987554-74987576 CCTGCACTCCTCCCTCACACCTT 0: 1
1: 1
2: 2
3: 60
4: 592
Right 992262794 5:74987573-74987595 CCTTCTTTTCTGATGGCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 239
992262786_992262794 -1 Left 992262786 5:74987551-74987573 CCTCCTGCACTCCTCCCTCACAC 0: 1
1: 0
2: 4
3: 115
4: 803
Right 992262794 5:74987573-74987595 CCTTCTTTTCTGATGGCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992262794 Original CRISPR CCTTCTTTTCTGATGGCACA GGG Intergenic
901091201 1:6642740-6642762 TCTTCGTTTCTGGGGGCACAGGG + Intronic
902750563 1:18506641-18506663 CTTTCTTTTCTGGTGGCTCTGGG + Intergenic
905082102 1:35332629-35332651 ACTTCTTTTATGGTGGCTCAGGG + Intronic
905809916 1:40904674-40904696 CCTTCTTTTCTCTTGAGACAGGG - Intergenic
905857734 1:41325512-41325534 CCTACTTTTCTGATCTCACCTGG - Intergenic
909830261 1:80180009-80180031 CCTTCTTAACTGATGGAGCAAGG - Intergenic
910101053 1:83577367-83577389 TCTTCTTTTTTGTTGGCATATGG + Intergenic
910323445 1:85976375-85976397 CCTACTTCTCTGATGACAGAGGG + Intronic
910728069 1:90359750-90359772 TCTTCTTTTATCATGTCACACGG - Intergenic
911212473 1:95156882-95156904 CCTTCATTTCTAATGGCATATGG - Intronic
912258319 1:108083743-108083765 TCTTCTTTCCTAAAGGCACAGGG - Intergenic
913389580 1:118295484-118295506 CCGCCTTTGCTGGTGGCACAGGG - Intergenic
914000488 1:143690622-143690644 CCTTCTTTTCTGTTTGCCCAAGG - Intergenic
916668543 1:166989808-166989830 CCTGCTTCTCTGAGGGCCCAGGG - Exonic
916687339 1:167159134-167159156 CCACTGTTTCTGATGGCACAGGG + Intergenic
920417791 1:205810355-205810377 CCTGCTCTTCAGATGGCCCAGGG - Exonic
921141313 1:212309646-212309668 CCTTCTTTTTTTCTGGCACATGG + Intronic
921522643 1:216175857-216175879 CGTTGGTTTCTGATGGCTCATGG + Intronic
922161931 1:223084496-223084518 CCTTCTTTCCTGAGGGCCTAAGG - Intergenic
924283583 1:242462708-242462730 CCTCCTCATCTGGTGGCACAAGG - Intronic
1063155682 10:3377064-3377086 CCTTTTTTTCTTTTGGGACATGG - Intergenic
1063294986 10:4796392-4796414 CCTTCCTTTCTGGTAGCAAATGG + Intronic
1064074391 10:12257302-12257324 CCTTCTGTCCTGATGACACTGGG + Intergenic
1065637622 10:27746379-27746401 GCCTCTTTTCTGATGTCACTGGG + Intergenic
1065645992 10:27834514-27834536 CCCTCTTTGATGATAGCACATGG - Intronic
1067815312 10:49470843-49470865 CCTTCTTTTTAGATGGCATTTGG + Exonic
1068711052 10:60134270-60134292 CCTGCTCTTTGGATGGCACAAGG + Exonic
1070708361 10:78657933-78657955 CCTTCTGTTCTGATGCCTCTGGG + Intergenic
1073010762 10:100357666-100357688 CTTTCTTTTCTAATGAGACAGGG + Intronic
1075440582 10:122476680-122476702 CCTGCATTTCTGATGGGGCAGGG - Intronic
1075939008 10:126372292-126372314 TCTTCTCTTTTGATGGTACAGGG - Intronic
1077846806 11:6034079-6034101 CCCTCTTATCTGAAGGCAGAAGG + Intergenic
1079103495 11:17556263-17556285 CTTCCATTTCTGATGACACAGGG + Intronic
1080425620 11:32151452-32151474 CCTTCTTTTCTGTGGCCAGAAGG - Intergenic
1081303219 11:41478829-41478851 ACTTCTTTTCTGAAGGCAAGAGG - Intergenic
1081794020 11:45807584-45807606 TATTCTTTGCTGATGGCTCAGGG + Intronic
1084388192 11:68857425-68857447 GCTTCTTTTCTTATGGTAAAGGG + Intergenic
1084937551 11:72595231-72595253 CCTTCTCTGCTGAGGGCAAAGGG - Intronic
1086154218 11:83647934-83647956 ACTTCTTTGCAGATGTCACAAGG - Intronic
1087013941 11:93538387-93538409 CCCTCTTCCCTGGTGGCACAGGG - Intronic
1087982305 11:104630863-104630885 CATTTTTTTCTGATGGCTTATGG - Intergenic
1089221721 11:116877508-116877530 CTTGAATTTCTGATGGCACAAGG + Intronic
1089381418 11:118035538-118035560 CCTTCTGTTCTGATGGCACCTGG - Intergenic
1091951780 12:4598795-4598817 CCCTCATTTCTGATGTGACAAGG - Intronic
1092896826 12:13020165-13020187 CCTTCTTACATGATGGCCCAGGG - Intergenic
1094499823 12:31011675-31011697 CTTTTTTTTTTGGTGGCACAGGG - Intergenic
1097510825 12:60537186-60537208 TCTTCTTTTCTTTTGGGACAGGG - Intergenic
1098568897 12:71967227-71967249 CCTTCTTCTCTGCAGGCACAAGG + Intronic
1100672746 12:96834729-96834751 CCTTCTTTTCTCCTGCAACATGG + Intronic
1102708592 12:114905293-114905315 CCCTCTTTGCTGATGGCTGAAGG + Intergenic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104450255 12:128863290-128863312 CCTTCTTTCCTTCTGGTACAAGG + Intronic
1107036130 13:35904633-35904655 CCTTCTTTCCTAAAGGCAAAAGG - Intronic
1108321155 13:49291819-49291841 CCTTATTTTCTGAATGAACAAGG - Exonic
1108906095 13:55476109-55476131 CCTTATCTTCTAATGGCACAGGG - Intergenic
1109103995 13:58225247-58225269 CTTTCTTATATGATGGCAGATGG - Intergenic
1112428208 13:99324399-99324421 CCTGCTTTTCTCATGGCAAAGGG - Intronic
1112503781 13:99961230-99961252 CCTTCTTTTCTGCTGGCTTAAGG + Intergenic
1113765487 13:112878282-112878304 CCTGAGTTTCTGATGGAACAAGG + Exonic
1114649222 14:24273005-24273027 CCTTCTTTGCAGTAGGCACAGGG - Intergenic
1116077273 14:40126944-40126966 TCTTCTTTTCTAATGGAACCTGG + Intergenic
1116434627 14:44882839-44882861 CTTTCTTTTCTGATTGCTCTAGG - Intergenic
1116774091 14:49159801-49159823 CCATCTTTGCTGATGGATCAGGG + Intergenic
1118548670 14:66924215-66924237 CCTGCTGTTGTCATGGCACACGG + Exonic
1119059488 14:71460650-71460672 CATTATGTTCTGCTGGCACAGGG - Intronic
1120459102 14:84771207-84771229 CCATCTTTGCTCATGGCATATGG - Intergenic
1121118944 14:91363894-91363916 CTTTCTGTTCTGATGCCACGTGG - Intronic
1121972208 14:98368505-98368527 CCTGCTTCTCTGATAGCACTGGG + Intergenic
1123183064 14:106487931-106487953 CCTTATTTCCTGATGAGACAAGG + Intergenic
1124331323 15:28819097-28819119 CCTCCTTTTCTCATGGAAGAAGG + Intergenic
1125575327 15:40751559-40751581 CCTGCTTTCCAGATGCCACATGG - Exonic
1129552530 15:76468626-76468648 CCCTCTTTTGTGATGTCTCAGGG + Intronic
1130327497 15:82892721-82892743 CCTACTTCTATGATGTCACAAGG - Exonic
1132234565 15:100209516-100209538 CCCTCCCTTCTGATGGCCCAGGG + Intronic
1132779883 16:1617377-1617399 CCTTCTTTTCTGACGGGTAATGG - Intronic
1132783158 16:1639738-1639760 CCTTCTTTCTTCATGGCAGATGG - Intronic
1134149478 16:11795280-11795302 CCTGCTTCTCTGATGGCATGTGG - Intronic
1134842028 16:17409455-17409477 CCATCTTTTCTCCTGGCAAAAGG - Intronic
1135032034 16:19046148-19046170 CCTTTTGTGCTGATGGCAGAAGG - Intronic
1136132150 16:28229797-28229819 TCTTTTTTTCTTCTGGCACATGG - Intergenic
1138765210 16:59594029-59594051 CCTTGTTTTCTTATAGAACATGG + Intergenic
1139269943 16:65672443-65672465 AAGCCTTTTCTGATGGCACAAGG + Intergenic
1139365370 16:66429266-66429288 CCTTCATTTCTGGTGCCTCATGG - Intronic
1140179883 16:72704605-72704627 CCTTCTTTTTTTATGACATAGGG - Intergenic
1140264387 16:73407974-73407996 CCTTCTCTTGTGATGGCAACAGG + Intergenic
1142850207 17:2701098-2701120 CCGCCTTGTCTCATGGCACACGG - Intronic
1144533836 17:16067649-16067671 CTCTCTTATCTGATGGCACTTGG - Intronic
1148213948 17:45824455-45824477 CCTTCTTTTCAGTTGGCTGATGG + Intronic
1149283812 17:55139201-55139223 AATTCTATTCTGATGGCACAGGG + Intronic
1149418047 17:56480841-56480863 TCTTCTTTTTTTATGGCTCATGG + Intronic
1151160178 17:72158629-72158651 CCGTCTTTGTTGATGGCACAAGG - Intergenic
1152706381 17:81845732-81845754 CTTTCTTTTCAGATGCCCCATGG - Exonic
1153833876 18:8947312-8947334 CCTTTTTTTCTGATTGCAGTTGG - Intergenic
1154133938 18:11760030-11760052 CATCATTTTCTGATGGCACTGGG - Intronic
1156839986 18:41599833-41599855 CCTTCTTTTCTAAAGACACCAGG - Intergenic
1157047364 18:44118545-44118567 CTTTCTTTTCAGAGGGCACTTGG - Intergenic
1159313718 18:66743082-66743104 CCTTCTTTAACGATGGCACCTGG + Intergenic
1159802229 18:72915681-72915703 CTTTCTTTTCTGATTGCTCTAGG + Intergenic
1163420953 19:17213356-17213378 CCTTCTTGGCTGAGGCCACAGGG - Intronic
1163743738 19:19032953-19032975 CCTTGTTCTCTGCTGGCAAAGGG + Intronic
1164712764 19:30369645-30369667 CCTGCTTATCTTATGGTACAGGG - Intronic
1166834893 19:45661295-45661317 CCTTCTTTTCTTTTGAGACAGGG + Intergenic
925107875 2:1308728-1308750 CTTTTTTTTCTGATAGCTCAGGG + Intronic
925114805 2:1369665-1369687 CCTTCATGACTGATGGCACCTGG + Intergenic
925342291 2:3145918-3145940 CCTTCCTTCCTGGTGGCACACGG + Intergenic
927496613 2:23555529-23555551 CTTCCTTTCCTGTTGGCACATGG - Intronic
931691102 2:64835518-64835540 CCGGCTTTTCTTAGGGCACATGG + Intergenic
933569541 2:83993232-83993254 CTTTCTTTTCCTATGACACAAGG - Intergenic
935286128 2:101565008-101565030 CCTTCTTTCCAGATGCCACCAGG - Intergenic
936059459 2:109284957-109284979 ACTTCACTTCTGATGGCACAAGG - Intronic
937689889 2:124743489-124743511 CCTTCTTTTTTGCAGACACAGGG + Intronic
937814807 2:126239397-126239419 CCTACTATTCTGATGGGAGAGGG + Intergenic
939062700 2:137442581-137442603 CTTTCTTTCCTTATGCCACAAGG - Intronic
939502075 2:143000155-143000177 CCTACTTTTCTGTTGCTACATGG + Intronic
942141617 2:172983251-172983273 CCTTCTCTTCTGATCTCAGAGGG - Intronic
942494998 2:176530828-176530850 TTTTCTTTTCTTATGGCACCAGG - Intergenic
942609177 2:177724761-177724783 GCTTCTTTTCTTCTAGCACAGGG - Intronic
942935224 2:181547836-181547858 CTTTCTTTTAGGAGGGCACAGGG - Exonic
943007188 2:182400199-182400221 CCTTCTTTTATCATGGGAAAAGG - Intronic
944452950 2:199861643-199861665 CCTTCTTTGCTGATTGTACATGG - Intergenic
948221934 2:236276874-236276896 CCTTCTTCTCAGGTGGTACAAGG - Intergenic
948381710 2:237554900-237554922 CGTTTTTATCTGATGCCACAAGG - Exonic
948496630 2:238354227-238354249 CCTTGTTTTCTGATACGACAAGG + Intronic
1169807400 20:9573703-9573725 CCTTCTGTTCTGAGGGCAGGGGG + Intronic
1169853117 20:10074939-10074961 CCCTCTTTGCTGTTGGCATAGGG + Intergenic
1170835801 20:19883631-19883653 CCTCCTTTTCTGACTGGACATGG - Intergenic
1170858503 20:20080335-20080357 CTTTCTTTTCTGATGGTGCCTGG + Intronic
1171097978 20:22350570-22350592 ACTTCTTTTCTGAGGATACAAGG - Intergenic
1173307949 20:41869230-41869252 CCTTCTTTGCTGATGGCTCAAGG + Intergenic
1175526205 20:59635769-59635791 CCCACTTTTCTGCTGGGACAGGG + Intronic
1177902726 21:26936085-26936107 CCTTTTCTTCTGATGCCATATGG + Intronic
1178480185 21:32973755-32973777 CTTACTTTTCTGATGGCTCTGGG - Intergenic
1180151805 21:45952100-45952122 CATTCCTTTCTGATGGCCCCGGG - Intergenic
1181859807 22:25809434-25809456 CCTTTTTCTCTGAAGGCCCATGG + Intronic
1183936032 22:41262885-41262907 CCTTCTATTCTCATGGTGCATGG + Intronic
1184726180 22:46347959-46347981 CCTTCCTTCCTTATGCCACAGGG + Intronic
1185363475 22:50423298-50423320 CCTTCATTTCTTCTGGCAGACGG + Intronic
949312103 3:2711502-2711524 CCTACTTTTCTGAAGGAAGAAGG + Intronic
954909596 3:54092629-54092651 TTTTCTTTTCTGATTGCAGAGGG + Intergenic
956266564 3:67403179-67403201 CCTTCTTTTCTAACTGCAGAGGG + Intronic
956397504 3:68841428-68841450 CCTTCTTTCCTGACAGGACAAGG + Intronic
958767767 3:98390916-98390938 ACTTCTTTTCTGAGGACAAAAGG + Exonic
958777042 3:98497931-98497953 ACTTCTTTTCTGAGGGCAAAAGG + Exonic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
959743726 3:109752008-109752030 ACCTCTTTTCTGATGTCAGAGGG + Intergenic
961078764 3:124006185-124006207 CGTTCTTTTCTGAGGGCTCTAGG - Intergenic
961304710 3:125950254-125950276 CATTCTTTTCTGAGGGCTCTAGG + Intergenic
961759477 3:129155111-129155133 TCTTCTTTTCTAATTTCACAGGG + Intronic
962948215 3:140193224-140193246 TCTTCTTTTCTGATGCTCCAAGG + Intronic
964493768 3:157266423-157266445 CCATATGTTCTCATGGCACATGG + Intronic
967128477 3:186448073-186448095 CCTTGCTTACTGTTGGCACAAGG + Intergenic
968082449 3:195855961-195855983 CATTCTTTTATTTTGGCACAGGG + Intergenic
969060742 4:4432386-4432408 CCTTCCCTGCTCATGGCACACGG + Intronic
969417705 4:7071794-7071816 CCTTCTTTTCTGCTGACAGCTGG - Intergenic
969985418 4:11203987-11204009 CCTTTTTTTCATATGGTACAGGG - Intergenic
971352584 4:25866366-25866388 CCTAATTTTTTGATGGCAAAAGG - Intronic
971665639 4:29480129-29480151 CCTTCCTTTATGAAAGCACATGG + Intergenic
974008525 4:56585260-56585282 CCTTATCTTCTAATAGCACAGGG - Intronic
974225784 4:59041530-59041552 CTTTGCTTTCTGATGGCTCAGGG - Intergenic
975091223 4:70406625-70406647 ACTGCTTTTATGAAGGCACAGGG + Intronic
975659718 4:76676350-76676372 CATTCATCTCTGATGCCACATGG - Intronic
977892485 4:102328097-102328119 CCTTCTATTTAGATGGCCCATGG + Intronic
979214170 4:118142779-118142801 CCTTCTTTTATAATTGCAAAAGG + Intronic
979292815 4:118996903-118996925 ACTTCTTTTCTGCTTGCAAATGG - Intronic
979789230 4:124757254-124757276 CCATATTTTCTTATGACACATGG - Intergenic
981359330 4:143829155-143829177 CCTCCCTTTTTGAAGGCACAGGG - Intergenic
981359337 4:143829187-143829209 CCTCCCTTTCTGAAGGCACAGGG - Intergenic
981370101 4:143950112-143950134 CCTCCCTTTTTGAAGGCACAGGG - Intergenic
981370108 4:143950144-143950166 CCTCCCTTTCTGAAGGCGCAGGG - Intergenic
981379872 4:144060201-144060223 CCTCCCTTTCTGAAGGCACAGGG - Intergenic
982361491 4:154523987-154524009 CCTTCTTTGGGGGTGGCACAGGG - Intergenic
983094521 4:163545740-163545762 CCTTCATTTCTGATTGCAGTGGG - Exonic
983971579 4:173882012-173882034 CCTCCTGTACTGATGCCACATGG - Intergenic
984133520 4:175907662-175907684 TCCTCTTATCTGAAGGCACAGGG + Intronic
985310393 4:188591426-188591448 ACTTCTTTTCTGATGAAATAAGG - Intergenic
985856664 5:2433485-2433507 CATTCTTTTCTGAGTGCTCACGG + Intergenic
985949787 5:3214557-3214579 CCTTCCTCTATGATGCCACAGGG + Intergenic
988388299 5:30594999-30595021 CATTCTCTTCTGATTGCACTTGG + Intergenic
988732605 5:33988097-33988119 CCCTCTACTCTGATGGCACCCGG + Exonic
990509301 5:56475871-56475893 GTTTCTTTTCTCCTGGCACAGGG + Intronic
990516386 5:56534693-56534715 CTCTCTCTTCTTATGGCACATGG + Intronic
991235765 5:64395098-64395120 CCATATTTACAGATGGCACATGG + Intergenic
992262794 5:74987573-74987595 CCTTCTTTTCTGATGGCACAGGG + Intergenic
992404255 5:76441800-76441822 CCCTCTTTATGGATGGCACAGGG - Intronic
992844497 5:80731993-80732015 AATTCTATTCTAATGGCACAAGG - Intronic
993281316 5:85928376-85928398 CTTTCTTATCTGATGGCTCTGGG - Intergenic
994929817 5:106167118-106167140 CCTTGTTTTCTGATGACAACCGG - Intergenic
995396695 5:111694527-111694549 TCTTCTTTTCTAATCGCAAATGG - Intronic
995649251 5:114349382-114349404 CTTTGTTTTCTGATGGATCAAGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999260687 5:150237050-150237072 CCATCTTCTGTGATGGCACCAGG - Intronic
999625637 5:153517473-153517495 CCTCCCTTTCTGAGGGCCCAGGG - Intronic
1000572950 5:162937192-162937214 GCCTCTTTTCTAAAGGCACATGG + Intergenic
1000861028 5:166456347-166456369 CCTTCTTTTCTGAGGGCCAAGGG - Intergenic
1001249669 5:170137482-170137504 CCTTGTTTTTGGATGGCCCATGG - Intergenic
1001466876 5:171975247-171975269 CATTCTTTTCTAGTGGCATATGG - Intronic
1001870034 5:175145536-175145558 CTTTCTTTTCTTATTGCACTAGG - Intergenic
1002019105 5:176350772-176350794 CCTTATTTTGTGATGGGAGAGGG - Intronic
1002215079 5:177625606-177625628 TCTTCTTTGCTGAGGGCAGAAGG - Intergenic
1002675961 5:180912988-180913010 CCTTATTTTCTGTAGCCACAGGG + Intronic
1003255774 6:4473750-4473772 TTTTCTTTTCTGATTGCAAAAGG - Intergenic
1004079113 6:12373531-12373553 CCTGCTTTGTTGATGGCACAAGG - Intergenic
1004179780 6:13371262-13371284 TATTCTTTTCTCATGGCAAAAGG - Intronic
1004557147 6:16710136-16710158 ACTTTTTTTCTGATCGTACAGGG - Intronic
1005419644 6:25635605-25635627 TCTTCTATTCTGAGTGCACACGG - Intergenic
1006433187 6:34010859-34010881 CCTTCATTTCAGTTGGCACTGGG - Intergenic
1006436688 6:34029398-34029420 ACTTGTTTCCTGAAGGCACAGGG + Intronic
1007539294 6:42626259-42626281 CCTTCTTTTCTGATGATTTAAGG + Intronic
1013388194 6:109654048-109654070 CCATCTTTTCTCATGACTCAAGG + Intronic
1018019077 6:159741256-159741278 CCTTGTATTCTGATAGCATATGG + Intronic
1018696728 6:166396682-166396704 CCTTCCTTGCTGAGGCCACAGGG - Intergenic
1018904000 6:168064702-168064724 CCTTCTGTCCTGAAGGCCCAAGG - Intronic
1021065917 7:16172199-16172221 TCTTCTTGTATGATGGCAAAGGG - Intronic
1021434668 7:20600545-20600567 CATGCTATTCTGATGGCAGAGGG + Intergenic
1021486425 7:21173316-21173338 CCTTCATTTCTGATGGGGCCTGG - Intergenic
1021559403 7:21954734-21954756 CCTTCTCTTCTCTTGGAACATGG - Intergenic
1022641927 7:32195224-32195246 TCTTCCTTTCTGATGTCCCAAGG + Intronic
1028464569 7:91135769-91135791 CCTTCTTTTGTGCTGGCAAAGGG - Intronic
1028696105 7:93715088-93715110 ACTTCTTTTCTGATTACGCAAGG - Intronic
1031849162 7:126842801-126842823 CATTCTTTTCTGAAGGCTCTAGG - Intronic
1033524553 7:142197329-142197351 GATTCTTTTCTGATGCCACTGGG + Intronic
1034076709 7:148238773-148238795 CCTTCTTTTCTGTAGAAACATGG + Intronic
1035855271 8:2967981-2968003 CCCTCTTCTCTGATGGTTCACGG + Intronic
1036402531 8:8423005-8423027 CCTTCTTAGCTGATGGAGCAAGG + Intergenic
1038149431 8:24929247-24929269 TTTTCTTTTCTGATAACACATGG - Intergenic
1039248651 8:35636726-35636748 CCTTCCTTTCTGTTCTCACAAGG + Intronic
1039800199 8:40947816-40947838 CCTTCTCTAGTTATGGCACATGG - Intergenic
1039877072 8:41596043-41596065 GCTTCTTTTCTGATGGCCAACGG + Intronic
1041035887 8:53790086-53790108 CCCTGTTTTCTGTTAGCACATGG - Intronic
1041410694 8:57551086-57551108 CTTTCTTCTCAGATGTCACATGG + Intergenic
1041807767 8:61872401-61872423 CCCTCACTGCTGATGGCACAAGG + Intergenic
1042514833 8:69648126-69648148 TTTTTTTTTCTGAAGGCACAGGG - Intronic
1043733158 8:83711092-83711114 CTTGCTTTTCAGCTGGCACAGGG - Intergenic
1044299698 8:90569170-90569192 GTTTCTTTTCTCTTGGCACAGGG - Intergenic
1045421686 8:102022758-102022780 CATTCTTTTCTGCTGGAAGAAGG + Intronic
1045614757 8:103896821-103896843 ACTTCTTATATGATGGCTCAGGG + Intronic
1047288050 8:123505403-123505425 CATTTTATTCTGATGGCCCAGGG - Intronic
1047811498 8:128414682-128414704 TCTTGTTTTCTGATAGCAGAGGG + Intergenic
1048303209 8:133266390-133266412 CCTTCCTCTCTGCTGCCACACGG - Intronic
1050845098 9:10206339-10206361 CTTTCTTTTCCGAGGGCACTAGG + Intronic
1051374585 9:16390223-16390245 CCTGCTTTCGTGGTGGCACAGGG - Intergenic
1055432070 9:76254206-76254228 CTCTCTTTTCTGCAGGCACATGG - Intronic
1055635430 9:78272991-78273013 CCCTCTCTTCTCATGGCAAATGG - Intronic
1055668273 9:78573828-78573850 TCTTCATTTCTAAAGGCACATGG - Intergenic
1055899004 9:81213078-81213100 TCTTCTTTTCTTTTGGCACCTGG - Intergenic
1056319186 9:85420565-85420587 CCTTCTTGTCTCATGGCAGAAGG - Intergenic
1057397425 9:94692467-94692489 CCTTCTGTTCTGAGGGCAAAGGG + Intergenic
1058481940 9:105404696-105404718 CCTTATTTTCTGATGCCTAAAGG + Intronic
1058743662 9:107968600-107968622 CCTTGTTTTCCGATGGGACAGGG + Intergenic
1059360965 9:113741181-113741203 CCATCTTTTCAGGTGACACATGG + Intergenic
1059698523 9:116752290-116752312 CCTTCTTTTTACTTGGCACATGG - Intronic
1061685055 9:132269207-132269229 TCTGCTTTTCTGCTGGCACTGGG - Intronic
1062001370 9:134217380-134217402 TTTTCTTTTCAGATGGTACAGGG - Intergenic
1186367492 X:8910775-8910797 CCTTCTTTGCTCATAGCTCAGGG + Intergenic
1187392172 X:18893380-18893402 CATGCTTTCCTGATAGCACAGGG + Exonic
1189372921 X:40444293-40444315 TCTCCTTTTCTGAGGGAACAGGG - Intergenic
1192246847 X:69379776-69379798 CCTTCTTTGCTCATGGAACTTGG + Intergenic
1192248588 X:69392597-69392619 CCTTCTTTCCTGTGGGCAAATGG - Intergenic
1193320066 X:80111250-80111272 ACTTCATTTCTCATGGCACCTGG - Intergenic
1193986358 X:88245666-88245688 CCTTCCTTTCTGGTGGCTCTGGG + Intergenic
1195757563 X:108214227-108214249 CCTTCTTTTCTCTTTGAACAGGG - Exonic
1199061278 X:143357742-143357764 CCATGTTTTCTTATGGCATAAGG + Intergenic
1199154442 X:144530078-144530100 CCTTTGTGTCTGATGGGACATGG - Intergenic
1199643472 X:149883948-149883970 CCTGCTGTTCTGATGCCAGAGGG - Intronic