ID: 992263432

View in Genome Browser
Species Human (GRCh38)
Location 5:74993206-74993228
Sequence CTGATGACCCTGGGCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992263432_992263441 26 Left 992263432 5:74993206-74993228 CCTGTCTTGCCCAGGGTCATCAG No data
Right 992263441 5:74993255-74993277 GAATCCAGGTGGTCTCCATCCGG No data
992263432_992263443 28 Left 992263432 5:74993206-74993228 CCTGTCTTGCCCAGGGTCATCAG No data
Right 992263443 5:74993257-74993279 ATCCAGGTGGTCTCCATCCGGGG No data
992263432_992263436 0 Left 992263432 5:74993206-74993228 CCTGTCTTGCCCAGGGTCATCAG No data
Right 992263436 5:74993229-74993251 GTTAGAGAGTGACAATGCCCAGG No data
992263432_992263438 15 Left 992263432 5:74993206-74993228 CCTGTCTTGCCCAGGGTCATCAG No data
Right 992263438 5:74993244-74993266 TGCCCAGGCTAGAATCCAGGTGG No data
992263432_992263442 27 Left 992263432 5:74993206-74993228 CCTGTCTTGCCCAGGGTCATCAG No data
Right 992263442 5:74993256-74993278 AATCCAGGTGGTCTCCATCCGGG No data
992263432_992263437 12 Left 992263432 5:74993206-74993228 CCTGTCTTGCCCAGGGTCATCAG No data
Right 992263437 5:74993241-74993263 CAATGCCCAGGCTAGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992263432 Original CRISPR CTGATGACCCTGGGCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr