ID: 992266958

View in Genome Browser
Species Human (GRCh38)
Location 5:75028948-75028970
Sequence TCTGCAGATCAGACACATCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992266957_992266958 0 Left 992266957 5:75028925-75028947 CCACTTGACAAGGCGAGTCTTAC 0: 1
1: 0
2: 0
3: 4
4: 36
Right 992266958 5:75028948-75028970 TCTGCAGATCAGACACATCCTGG 0: 1
1: 1
2: 0
3: 17
4: 221
992266955_992266958 14 Left 992266955 5:75028911-75028933 CCTTCATAGTAATTCCACTTGAC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 992266958 5:75028948-75028970 TCTGCAGATCAGACACATCCTGG 0: 1
1: 1
2: 0
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992266958 Original CRISPR TCTGCAGATCAGACACATCC TGG Exonic
900884209 1:5403910-5403932 GCAGCAGCTCAGACACATCAGGG + Intergenic
902865201 1:19273472-19273494 TCTGCAGATCAGGCCCGTCAAGG + Intergenic
902867310 1:19288105-19288127 TCTGCAGATCAGGCCCGTCAAGG + Intronic
902902637 1:19530195-19530217 GGTGCAGATCACAGACATCCAGG - Intergenic
904747182 1:32718510-32718532 GCTGGAGACTAGACACATCCTGG - Intergenic
907167703 1:52429294-52429316 TCAGGAGATCAAGCACATCCTGG - Intronic
907270780 1:53289750-53289772 TTTGCAGACCAAGCACATCCTGG - Intronic
907279096 1:53333678-53333700 ACTGCAGATCAGAAATATTCAGG - Intergenic
909149729 1:71986747-71986769 TCTGCAAATCTGACACAGTCCGG - Intronic
909285441 1:73810747-73810769 TCTGCATATTAGACAGATCATGG - Intergenic
910219463 1:84875942-84875964 TCTGGAGATCATACACACCCAGG + Intronic
911037540 1:93566571-93566593 TCTTAGCATCAGACACATCCTGG - Intronic
912379724 1:109240793-109240815 TCTGCCTGTCAGACTCATCCTGG - Intergenic
916711885 1:167418137-167418159 CGTGCAGTTCAGACACATCGAGG + Exonic
920250786 1:204621016-204621038 GCAGCAGACCTGACACATCCAGG + Exonic
923304764 1:232678333-232678355 TCTGCAGACCAGACTCAACTGGG + Intergenic
1062938255 10:1403651-1403673 TCTGCAGATCAGCTACGCCCGGG - Intronic
1065213877 10:23431219-23431241 TCTGTTGATCAGCCCCATCCTGG + Intergenic
1067319061 10:45199662-45199684 ACCGCAGCTCAGCCACATCCAGG - Intergenic
1068731094 10:60358679-60358701 GCTGCAGAACAGACCCATCAAGG + Intronic
1069636495 10:69928467-69928489 TCTGCTGAGCAGAAGCATCCAGG - Intronic
1072029146 10:91500549-91500571 TCTGCAGAGCATGCATATCCAGG - Exonic
1074899050 10:117801233-117801255 TCTGCAGAGCAGGCCCCTCCTGG + Intergenic
1075574309 10:123567686-123567708 ACAGCAGACCAGACTCATCCCGG + Intergenic
1076027201 10:127125556-127125578 TCAGCTGCTCAGCCACATCCTGG + Exonic
1080315215 11:30939465-30939487 TCTGGTGAGCAGGCACATCCAGG + Intronic
1080403229 11:31956101-31956123 TCTGCAGCTCTGACCCAGCCAGG - Intronic
1081227548 11:40542767-40542789 TCTGCAGACCTCACACATTCTGG + Intronic
1089527574 11:119107414-119107436 TCTGCAGACCAGTCCCCTCCAGG + Exonic
1090074104 11:123568568-123568590 TCTGCAGATCTGACACAGAATGG - Intronic
1090592659 11:128289400-128289422 TCTGCAGCTCAGTAACACCCAGG + Intergenic
1090719505 11:129458906-129458928 TCTGCAGGTCAGCCACGGCCAGG + Intergenic
1091999299 12:5019434-5019456 TCTGCAGGCCAAACACAGCCTGG - Intergenic
1094061938 12:26323570-26323592 TCTGCAGGTGAGACACATTCTGG - Intergenic
1095386138 12:41652780-41652802 TCTGCAGATCAAACTCTTTCTGG - Intergenic
1096230899 12:49896242-49896264 TCTCCAGACCAGAACCATCCTGG - Intronic
1096750054 12:53752787-53752809 TCTGCAGTTCAGTCCAATCCCGG - Intergenic
1097199208 12:57264031-57264053 TCAGGAGATCAGGCCCATCCTGG + Intronic
1097665582 12:62474048-62474070 GCTGCACATCAAACACATCTAGG + Intronic
1098735766 12:74102028-74102050 TCAGGAGATCAGAACCATCCTGG + Intergenic
1100426946 12:94496441-94496463 TTTGCAGATAAGAGTCATCCAGG - Intergenic
1100492270 12:95092750-95092772 TGTGCAGATCATACACATTGTGG + Exonic
1101754109 12:107607617-107607639 TGTGCAGATCAGACCCCTCATGG + Intronic
1102284465 12:111644387-111644409 TCTGCAGATCACCGAGATCCAGG - Exonic
1106598530 13:31167739-31167761 TCAAGAGCTCAGACACATCCTGG - Intergenic
1106704050 13:32261669-32261691 TCTGCATATCACACTTATCCAGG - Exonic
1107757221 13:43637503-43637525 TCTGCAGCTCATAAACATCCAGG + Intronic
1107823123 13:44304190-44304212 TCTGCAGCACAGACAAATCTTGG - Intergenic
1108530525 13:51323404-51323426 TCTACAGATCAGACACTTGAGGG + Intergenic
1108750538 13:53443495-53443517 TCTGGAGATCAAGAACATCCTGG - Intergenic
1109339375 13:61035660-61035682 TTTGAAGATAAAACACATCCAGG - Intergenic
1110441604 13:75532618-75532640 TCAGGAGATCAGAATCATCCTGG + Intronic
1110864549 13:80379635-80379657 TCTGGTGATCAGCCCCATCCAGG + Intergenic
1112438583 13:99408820-99408842 ACAGCAGGTCAGACACAGCCAGG + Intergenic
1113671819 13:112180855-112180877 TCTGCAGCTCAAAGACACCCAGG + Intergenic
1114007658 14:18332342-18332364 ACTGCAGCTCAGCCCCATCCAGG + Intergenic
1118818669 14:69330586-69330608 TCTGTTGATCAGCCCCATCCCGG + Intronic
1119651678 14:76388394-76388416 TCAGGAGATCAGAACCATCCTGG - Intronic
1119772033 14:77226048-77226070 TCAGCAGAGCAGACACTTACCGG + Intronic
1120963000 14:90141996-90142018 TCAGCAGATCAAAACCATCCTGG - Intronic
1121002046 14:90458465-90458487 TCTGCAGTTCCAACATATCCAGG - Intergenic
1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG + Intronic
1128345459 15:66850048-66850070 TCTGGAGATCAGTCCCACCCTGG - Intergenic
1129977708 15:79836275-79836297 TCTGCATTTCTGACAAATCCTGG - Intronic
1132332809 15:101024518-101024540 TCTGCAGCCCAGACAGAGCCAGG + Intronic
1132633815 16:933034-933056 TTTGCAAATCTGACACAACCTGG - Intronic
1133143426 16:3765185-3765207 TCAGCAGATCAGGACCATCCTGG - Intronic
1133233150 16:4375851-4375873 GCTGCACATCAGAATCATCCAGG - Intronic
1134092348 16:11398330-11398352 TCTGCAGGGCAGACTCACCCTGG + Exonic
1134323851 16:13188853-13188875 TCTGCAGTTAAGTCACATTCTGG - Intronic
1137292120 16:47058875-47058897 TCTGGTGATCAGCCCCATCCTGG + Intergenic
1137753071 16:50880785-50880807 TATGAAGATCAGACACAGGCTGG + Intergenic
1137758723 16:50923325-50923347 TGTGCAGATAAGACACAGGCTGG - Intergenic
1138894142 16:61182572-61182594 TCTGCAGAGCACAGACATTCAGG - Intergenic
1140031888 16:71345550-71345572 TCTGAAGGTCAGTCACAGCCCGG - Intergenic
1140204221 16:72920712-72920734 TCTGCAGATGACACACAGACAGG - Intronic
1140315115 16:73888978-73889000 TCTGCTCATCAAACACCTCCAGG + Intergenic
1140797788 16:78456170-78456192 TCTGAATCTCAGACACAACCTGG - Intronic
1143122500 17:4617660-4617682 TCTGCAGACCAGAAACCACCAGG - Intergenic
1143307342 17:5958007-5958029 CCTGCAAACCAGACAGATCCGGG - Intronic
1148578594 17:48728143-48728165 TCTGCACCACAGACACGTCCAGG + Exonic
1150424092 17:65063350-65063372 TCCCCAGCTCAGACAGATCCTGG + Intergenic
1151745253 17:76008458-76008480 TCTGCAGCTCGGACTCCTCCCGG + Exonic
1152109630 17:78350605-78350627 TGTGCAGCACAGACACCTCCTGG + Intergenic
1152819219 17:82427861-82427883 TCTGCAGAAGGGCCACATCCTGG - Intronic
1153815612 18:8787466-8787488 ACTGCAGATCAGGCCCCTCCGGG - Intronic
1154449035 18:14459823-14459845 TCTGCCGCTCAGCCCCATCCTGG + Intergenic
1154492493 18:14932547-14932569 TCTGGAGATCAAAAACATCCTGG - Intergenic
1154529805 18:15331621-15331643 ACTGCAGCTCAGCCCCATCCAGG - Intergenic
1156192918 18:34740500-34740522 TCTGCAGAGTGGACACATACTGG + Intronic
1157117972 18:44880273-44880295 TCTGCAGAAAAGAGCCATCCAGG + Intronic
1157150284 18:45210142-45210164 TCTGCAAGACAGAAACATCCAGG + Intergenic
1157431879 18:47634898-47634920 TGTACAGATCAGAAACCTCCTGG + Intergenic
1157871562 18:51234411-51234433 TCTGTAGTACACACACATCCAGG - Intergenic
1159594929 18:70373729-70373751 TCAGCAGAACAAACACAGCCTGG + Intergenic
1160530673 18:79560565-79560587 CCGGCAGAGCAGACACAGCCTGG - Intergenic
1161237234 19:3204177-3204199 TCTGCGGAGCACACACATCGGGG + Intronic
1163090630 19:15017489-15017511 TGTCCAGATGAGACACAGCCTGG + Intronic
1165793986 19:38507878-38507900 TCTGCAGACCAGACTCACCTAGG + Intronic
1166121986 19:40691723-40691745 TATGCAGATCAGACTCATCAGGG - Exonic
1166578573 19:43869424-43869446 TCAGCAGATCAAGCCCATCCTGG + Intergenic
924991381 2:315761-315783 TCTGCAGCCCAGACACCTGCTGG + Intergenic
925206750 2:2013645-2013667 TCTGCAGATCGGGGACATGCTGG + Intronic
926314930 2:11702474-11702496 TCTGCAGGCCAGCCACACCCTGG + Intronic
926699053 2:15790565-15790587 CCTGCAGAACAGGCACGTCCGGG - Intergenic
927226989 2:20776909-20776931 TCTGGAGATGAGATACATCTGGG + Intronic
927437264 2:23077561-23077583 TCTGAACATCAGAAACAGCCAGG - Intergenic
928300514 2:30120051-30120073 TCTGCATTTCAGAGACATCTAGG + Intergenic
929756270 2:44768294-44768316 TCTGCAGAGTTGGCACATCCTGG + Intronic
930397688 2:50844147-50844169 TCTGGTGAGCAGGCACATCCAGG + Intronic
934956094 2:98621249-98621271 TCTCCAGATAAGACCCAGCCTGG - Exonic
937343067 2:121104353-121104375 TCTGCAGATCAGACTCATCCTGG + Intergenic
938528900 2:132163061-132163083 ACTGCAGCTCAGCCCCATCCAGG - Intronic
944296003 2:198063063-198063085 TCTTGAGATGAGACACATCTGGG + Intronic
944902664 2:204231538-204231560 TCTCCAGAGCAGACAGAGCCAGG + Intergenic
948855392 2:240727935-240727957 TCTGCAGAGTAGCCACATTCTGG - Intronic
948914079 2:241021497-241021519 TGTCCAGAACAGACAAATCCAGG - Intronic
949057075 2:241933524-241933546 TCTGCAGACCAAACACACCAAGG + Intergenic
1168730870 20:79748-79770 TGCACAGATCAGACACACCCAGG - Intergenic
1168826513 20:818087-818109 TCTGCACATGATACAGATCCAGG + Intergenic
1170351952 20:15451524-15451546 TCTGCAGGTCTGACAGCTCCAGG - Intronic
1170352180 20:15453801-15453823 TCTTCAGACCAGACACTTGCTGG - Intronic
1171058630 20:21933618-21933640 TCTGCAGCTGAGACACACCCTGG - Intergenic
1171164145 20:22956021-22956043 TCTACACATCAGACACATGCTGG - Intergenic
1172197478 20:33102018-33102040 AGTGCACATCAGAGACATCCAGG + Intronic
1172441618 20:34970363-34970385 TCTGCTGTTCAGACACACCCTGG + Intergenic
1173135996 20:40439670-40439692 GCTTCAGAGCAGACACTTCCAGG + Intergenic
1176767606 21:13036851-13036873 ACTGCAGCTCAGCCCCATCCAGG + Intergenic
1179332284 21:40415630-40415652 TCTGCAGATCAGATTTCTCCAGG - Intronic
1179898987 21:44379223-44379245 TCTGCAAAGCAGCCACATGCTGG - Intronic
1180432165 22:15263152-15263174 ACTGCAGCTCAGCCCCATCCAGG + Intergenic
1180514732 22:16131089-16131111 ACTGCAGCTCAGCCCCATCCAGG + Intergenic
1181692109 22:24569068-24569090 TTTGCCGAGCAGACACAGCCCGG + Intronic
1182458553 22:30468516-30468538 TCTGCAGGTCACACTCATGCAGG + Exonic
1182629390 22:31673232-31673254 TCAGGAGATCAGAACCATCCTGG - Intergenic
1183457545 22:37930825-37930847 TCTGCTGGTCAAACACTTCCTGG + Intronic
1185231891 22:49688305-49688327 CCGGCGGATCTGACACATCCAGG - Intergenic
950122686 3:10492303-10492325 TCTGCTGATTAGACCCATGCAGG - Intronic
951793933 3:26517380-26517402 TCAGGAGATCAGGCCCATCCTGG - Intergenic
952639363 3:35573842-35573864 TCAGCAAATCAGTCACATCTTGG - Intergenic
952719709 3:36519630-36519652 TCTGTAGATCACAAACTTCCTGG - Intronic
955614644 3:60793782-60793804 TCTGCAGCTAAGAGCCATCCTGG + Intronic
957826203 3:85448118-85448140 TCAGCAGATCAAAACCATCCTGG + Intronic
958854907 3:99373224-99373246 TCTGCATGTCAGACAGAGCCTGG + Intergenic
959780975 3:110232924-110232946 TCTGGAGATCAAAACCATCCTGG - Intergenic
960906468 3:122606633-122606655 GCTGCAGATCATAATCATCCGGG + Intronic
961228461 3:125276750-125276772 TAAGCAGACCAGACACATTCAGG + Intronic
961447334 3:126987038-126987060 CCAGCACATCAGGCACATCCAGG + Intergenic
962108784 3:132420223-132420245 TCTGCACAGCAGACTCACCCAGG - Intronic
962850417 3:139304248-139304270 TCTCCAGATCAGAGACATCTGGG + Intronic
963106757 3:141654013-141654035 ACTGCAGATCAAAGAAATCCTGG - Intergenic
963830585 3:150004206-150004228 TCTGCAAATGAGACCCACCCTGG + Intronic
964319994 3:155485695-155485717 TCTTCAGAACAGACAACTCCAGG - Exonic
968348613 3:198032988-198033010 TCTGCAGATCAGTTTCTTCCTGG + Intronic
968849788 4:3071313-3071335 TCTGCATAAAAGCCACATCCTGG - Intergenic
968949776 4:3684417-3684439 TCTGCGGATCTGAGACCTCCAGG + Intergenic
970420947 4:15905425-15905447 CATGCAGAGCAGTCACATCCAGG + Intergenic
970497972 4:16646578-16646600 GCTGCAGATCAGATTCATTCAGG - Intronic
971790775 4:31167533-31167555 TCTGCAACACAGACACACCCAGG + Intergenic
972329285 4:38049581-38049603 ACAGCAGATCAGACACACCATGG - Intronic
973812987 4:54590937-54590959 ACTGCAGATCAGAAACTTCCAGG + Intergenic
978671948 4:111259574-111259596 TCTCCAGCTCAGACAAATCTGGG - Intergenic
981338709 4:143595674-143595696 TCTGCAGATCAAGACCATCCTGG + Intronic
983250160 4:165334911-165334933 ACTGCAGATCAGAAATATTCAGG + Intronic
983280660 4:165677139-165677161 TGTGAAGATGAGACACACCCGGG + Intergenic
984561139 4:181272060-181272082 TTTGAAAATCAGACACATCTGGG - Intergenic
985796577 5:1966578-1966600 TCTGCAGCACAGACACCTCCTGG + Intergenic
986286540 5:6363117-6363139 TGTTCAGCTCAGACACAGCCCGG - Intergenic
989566608 5:42907347-42907369 ACTCCAGATCAGACAATTCCAGG - Intergenic
989645797 5:43631254-43631276 CATGCAGATCAGACAAACCCCGG + Intronic
992266958 5:75028948-75028970 TCTGCAGATCAGACACATCCTGG + Exonic
992845766 5:80745293-80745315 TCTGCATATCAGAATCATCTGGG - Intronic
995000146 5:107118272-107118294 TCAGATGATCAGACACAGCCTGG + Intergenic
995883387 5:116867271-116867293 TCAGGAGACCAGAAACATCCTGG - Intergenic
996166284 5:120228112-120228134 TCTGTAGATCAGTAGCATCCAGG - Intergenic
997647530 5:135491068-135491090 CCTGCAGATTATACACCTCCGGG - Intergenic
999474066 5:151881895-151881917 TCTGGAGAACAAACACAGCCTGG + Intronic
1000173420 5:158726739-158726761 TCTGCAGAGGAGACACCTCAAGG + Intronic
1004427247 6:15514614-15514636 TCTGACGATCTGACTCATCCGGG - Intronic
1005050185 6:21677129-21677151 TCAGCAGATCAGTAACATCATGG + Intergenic
1006194257 6:32228353-32228375 TCTCAAGATCATACACTTCCCGG + Intergenic
1007407327 6:41642535-41642557 TCTGCAGAGGAGACACTGCCCGG - Intronic
1017257633 6:152351898-152351920 GCTGCAGAACGGACACATGCGGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019934016 7:4242619-4242641 TCTGGAGAACAGACAGCTCCGGG + Intronic
1020736997 7:11963231-11963253 TCTGCTGGTCAGACACATTTAGG - Intergenic
1022391156 7:29945728-29945750 TCTGCAGATGAGAAAAATCAAGG - Intronic
1022509366 7:30925428-30925450 TATGCAGAGCAGACAGATGCAGG - Exonic
1022958052 7:35399389-35399411 CCTGCAGCTTAGACACATCCAGG - Intergenic
1026295950 7:69052608-69052630 TGAGCTTATCAGACACATCCTGG - Intergenic
1029019834 7:97352809-97352831 TCTGAAAATCTGACACATCATGG - Intergenic
1029595888 7:101537524-101537546 TCTCCAGGTCAGACACAGCCAGG + Intronic
1030147811 7:106374178-106374200 TTTGCAGATCATCCACTTCCAGG - Intergenic
1031513589 7:122676677-122676699 TCAGCTGCTCAGCCACATCCTGG + Intronic
1032641377 7:133772902-133772924 TCTCAAGCTCAGAAACATCCAGG - Intronic
1035289073 7:157825731-157825753 TCTGCAGATCTGAGAAAACCTGG + Intronic
1035451526 7:158980126-158980148 CCTGCAGATCTGACAGATGCAGG + Intergenic
1035615709 8:999898-999920 TCTCTAGAGCAGACAGATCCGGG + Intergenic
1035615716 8:999950-999972 TCTCTAGAGCAGACAGATCCGGG + Intergenic
1035615723 8:1000002-1000024 TCTCTAGAGCAGACAGATCCGGG + Intergenic
1035615737 8:1000106-1000128 TCTCTAGAGCAGACAGATCCGGG + Intergenic
1035615743 8:1000158-1000180 TCTCTAGAGCAGACAGATCCGGG + Intergenic
1035615785 8:1000418-1000440 TCTCTAGAGCAGACAGATCCGGG + Intergenic
1038039933 8:23715939-23715961 TCTGGAGATCAGGACCATCCTGG + Intergenic
1038351248 8:26778082-26778104 CCAGCAGCTCAGACTCATCCAGG - Intronic
1038857529 8:31349693-31349715 TCTGGTGACCAGACATATCCTGG - Intergenic
1039167708 8:34703728-34703750 TCTGAAGGTCAGGCACCTCCCGG + Intergenic
1039863439 8:41479454-41479476 TCTGCAGATTAGACACAACATGG + Intergenic
1043857662 8:85279780-85279802 TCTGCAGATCATAACAATCCAGG - Intronic
1045338913 8:101234144-101234166 TCTGCAAAGCAAACACTTCCAGG - Intergenic
1046252749 8:111653926-111653948 TCTACATATCAGATACATTCAGG - Intergenic
1048508583 8:135042446-135042468 TCTGCAGTTGAGACAGATCCTGG - Intergenic
1049447638 8:142638713-142638735 TCTCCAGCTCAGACACTTTCTGG + Intergenic
1049545830 8:143230098-143230120 CCTGCAGAGCTGACCCATCCCGG - Intergenic
1050136357 9:2469670-2469692 TGTGCAGCTCAGACAAATTCAGG - Intergenic
1054417423 9:64890158-64890180 ACTGCAGCTCAGTCCCATCCAGG - Intergenic
1056283340 9:85063625-85063647 TCCACATGTCAGACACATCCTGG + Intergenic
1056591450 9:87968809-87968831 TCTGCACATCTGGCACATGCAGG - Intronic
1056667784 9:88595389-88595411 CCTGAAGATCATGCACATCCTGG + Intergenic
1057667795 9:97059865-97059887 TCTTCAGATGAGACTCACCCAGG - Intergenic
1059484554 9:114616859-114616881 TCTCCAGCTCAGGCACAGCCAGG - Intronic
1059889469 9:118785370-118785392 TCTGCCGTTCACACATATCCAGG + Intergenic
1060046198 9:120343143-120343165 TCTGCAGATCAGTCAGATCTTGG + Intergenic
1061047993 9:128177706-128177728 TCTGCAGAGCAGTGACAGCCGGG - Exonic
1061537299 9:131258042-131258064 TCTCCACTTCAGAAACATCCAGG + Intergenic
1061902050 9:133678021-133678043 TCTGGAGGTCAGACCCTTCCAGG + Intronic
1061993175 9:134171070-134171092 TCTGCAGATCAGTCCCTTCAAGG - Intergenic
1062351592 9:136142323-136142345 TCTGCAGAGCTGGCACATCCAGG + Intergenic
1186454513 X:9700528-9700550 TCGGCAGGTCAGACATATCTAGG + Intronic
1189167109 X:38870967-38870989 TGTGCAGATAATACACAGCCTGG - Intergenic
1189383938 X:40521510-40521532 TCTGCAGATGACCCACCTCCTGG - Intergenic
1189831330 X:44976630-44976652 TCTGCAGATCAAAAATATTCAGG - Intronic
1190218290 X:48494354-48494376 TTTCCAGCTCAGAGACATCCCGG - Intergenic
1190331278 X:49236955-49236977 CCTACAGTTCAGACAGATCCTGG - Intronic
1195785442 X:108515436-108515458 TATGCATATAAGACATATCCTGG + Intronic
1196872165 X:120122998-120123020 TCTGCAGAACAGACTCAGGCTGG + Intergenic
1199188335 X:144941276-144941298 AGAGCAGATCAGTCACATCCTGG + Intergenic
1199228422 X:145407137-145407159 TCAGGAGATCAAGCACATCCTGG + Intergenic
1199602158 X:149547884-149547906 GCTGCTGACCAGACACTTCCTGG + Intronic
1199648229 X:149931592-149931614 GCTGCTGACCAGACACTTCCTGG - Intronic