ID: 992270074

View in Genome Browser
Species Human (GRCh38)
Location 5:75054385-75054407
Sequence GAAAGGACGTGGAGCCTCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992270074_992270092 15 Left 992270074 5:75054385-75054407 CCCGCGAGGCTCCACGTCCTTTC No data
Right 992270092 5:75054423-75054445 CAGGGCTTGCCTTTCAGGGCAGG No data
992270074_992270094 21 Left 992270074 5:75054385-75054407 CCCGCGAGGCTCCACGTCCTTTC No data
Right 992270094 5:75054429-75054451 TTGCCTTTCAGGGCAGGGAGTGG No data
992270074_992270088 10 Left 992270074 5:75054385-75054407 CCCGCGAGGCTCCACGTCCTTTC No data
Right 992270088 5:75054418-75054440 GCTCCCAGGGCTTGCCTTTCAGG No data
992270074_992270089 11 Left 992270074 5:75054385-75054407 CCCGCGAGGCTCCACGTCCTTTC No data
Right 992270089 5:75054419-75054441 CTCCCAGGGCTTGCCTTTCAGGG No data
992270074_992270085 -4 Left 992270074 5:75054385-75054407 CCCGCGAGGCTCCACGTCCTTTC No data
Right 992270085 5:75054404-75054426 TTTCGGGGCCGGGGGCTCCCAGG No data
992270074_992270086 -3 Left 992270074 5:75054385-75054407 CCCGCGAGGCTCCACGTCCTTTC No data
Right 992270086 5:75054405-75054427 TTCGGGGCCGGGGGCTCCCAGGG No data
992270074_992270093 16 Left 992270074 5:75054385-75054407 CCCGCGAGGCTCCACGTCCTTTC No data
Right 992270093 5:75054424-75054446 AGGGCTTGCCTTTCAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992270074 Original CRISPR GAAAGGACGTGGAGCCTCGC GGG (reversed) Intergenic
No off target data available for this crispr