ID: 992270080

View in Genome Browser
Species Human (GRCh38)
Location 5:75054394-75054416
Sequence CTCCACGTCCTTTCGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992270073_992270080 -4 Left 992270073 5:75054375-75054397 CCAGGAGTCTCCCGCGAGGCTCC No data
Right 992270080 5:75054394-75054416 CTCCACGTCCTTTCGGGGCCGGG No data
992270070_992270080 24 Left 992270070 5:75054347-75054369 CCACGCTGTGCTTGCTATTCACG No data
Right 992270080 5:75054394-75054416 CTCCACGTCCTTTCGGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992270080 Original CRISPR CTCCACGTCCTTTCGGGGCC GGG Intergenic
No off target data available for this crispr