ID: 992277810

View in Genome Browser
Species Human (GRCh38)
Location 5:75139018-75139040
Sequence CCAAATGCTGATTGTTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992277808_992277810 0 Left 992277808 5:75138995-75139017 CCAAACAAGAGGTTTATTTTCTG 0: 1
1: 0
2: 3
3: 28
4: 283
Right 992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG 0: 1
1: 0
2: 0
3: 22
4: 238
992277806_992277810 12 Left 992277806 5:75138983-75139005 CCTGTAAATTTGCCAAACAAGAG 0: 1
1: 0
2: 0
3: 15
4: 161
Right 992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG 0: 1
1: 0
2: 0
3: 22
4: 238
992277804_992277810 28 Left 992277804 5:75138967-75138989 CCTACCTGCTTTCATTCCTGTAA 0: 1
1: 0
2: 2
3: 23
4: 287
Right 992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG 0: 1
1: 0
2: 0
3: 22
4: 238
992277805_992277810 24 Left 992277805 5:75138971-75138993 CCTGCTTTCATTCCTGTAAATTT 0: 1
1: 0
2: 1
3: 31
4: 388
Right 992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG 0: 1
1: 0
2: 0
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992277810 Original CRISPR CCAAATGCTGATTGTTATAA AGG Intronic
908483356 1:64565916-64565938 CGTAATGCTGATTATTATCACGG - Intronic
908608727 1:65831247-65831269 CCAAAAGCTGACTCTTTTAAAGG + Intronic
908908491 1:69044389-69044411 ACTAATGCTCATTGTTACAAAGG - Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909470673 1:76024520-76024542 CAAAATGTTGATTGTTTGAATGG + Intergenic
909900948 1:81134581-81134603 CAAAATACTGATTAATATAAAGG - Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912428626 1:109616357-109616379 CAAAATGATAATGGTTATAAAGG - Exonic
913520517 1:119641226-119641248 ACTGATGCTTATTGTTATAAGGG + Intronic
915614537 1:157026797-157026819 ACAAATGCTAACTGTTATTATGG + Intronic
915773947 1:158461977-158461999 CCAAATTCTGAGAATTATAAAGG - Intergenic
917776844 1:178346628-178346650 CCAAGTGCTGTTTTTTATAGGGG - Intronic
917823012 1:178785440-178785462 CCAAATACTCAATTTTATAAGGG - Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920694393 1:208170945-208170967 GCAAATGCTGAATATTATAGAGG + Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922379176 1:225004611-225004633 CCTAGTGGTGATTGTTATGAGGG + Intronic
924250005 1:242123213-242123235 CCATAGGCTAATTGATATAAAGG + Intronic
1064497475 10:15927869-15927891 ACAGATGCTGCTTGTTATACAGG + Intergenic
1066472136 10:35709439-35709461 CCAAATGCTGTATGTTCTCAGGG - Intergenic
1068218991 10:54019413-54019435 TCAAATGCTGATGTTTATGATGG + Intronic
1068721814 10:60254068-60254090 GCAAATGCTGATTTATATAAGGG - Intronic
1068946410 10:62733879-62733901 CCAAATGCTTATTGCTGGAATGG - Intergenic
1070431946 10:76349093-76349115 CCAAATGCTGATCCTCACAATGG - Intronic
1071512079 10:86268336-86268358 CCAAATGCTGTTGGTGATACCGG - Intronic
1071871747 10:89802885-89802907 CCAAATGGTGATTCCTCTAATGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073308473 10:102522379-102522401 CCAAATCTTGACTGTTCTAAGGG - Intronic
1076048281 10:127312521-127312543 TAAAATGCTGCATGTTATAAAGG - Intronic
1076221719 10:128739140-128739162 CCAGATGCTGATTCTCATAAAGG - Intergenic
1079796224 11:24806508-24806530 CCAATTGCTTATTTTTACAAGGG + Intronic
1080132167 11:28809165-28809187 GAAAATGCTTATTTTTATAAGGG - Intergenic
1080292490 11:30686692-30686714 CAAAATGCTGGTTGTAACAACGG - Intergenic
1080391904 11:31855825-31855847 CCAAAGGCTGAGTGATATCAGGG - Intronic
1080510831 11:32969500-32969522 GGAAACGCTGATTTTTATAAGGG + Intronic
1080729080 11:34929893-34929915 TCAAATGCTGATAGTTACATTGG + Intronic
1081014247 11:37856349-37856371 CAAAAATCTGATTGTTAAAAAGG - Intergenic
1081944984 11:46984017-46984039 ACAAATGCTGATTGGTATGAAGG + Intronic
1082302387 11:50524208-50524230 CCAAATGTTGATTTTCAGAATGG - Intergenic
1082586388 11:54946924-54946946 CCAAATGTTGTTTGGTAGAATGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1087698998 11:101414136-101414158 TCAAATGCTGATTCTTCTATTGG + Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088604813 11:111518504-111518526 CCAAATGGTGATAATCATAATGG - Intronic
1091924776 12:4336642-4336664 CCAAATGCTCAGTATTATAATGG - Intronic
1092857853 12:12691929-12691951 CCAACTTTTGATTGTTATATAGG - Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095196987 12:39331237-39331259 CCAAATGTTGAAGGTGATAATGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095624592 12:44299787-44299809 CCATATCCTGTTTGTTATACTGG - Intronic
1097540340 12:60935368-60935390 TCAAATGCTGATTGTGGTCATGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099988015 12:89691124-89691146 CCAAATGCTGAATGGCAGAAAGG - Intronic
1100449668 12:94693639-94693661 CCAAATGCTCAATATTACAAAGG + Intergenic
1100509876 12:95259949-95259971 CTATATACTGATTATTATAACGG - Intronic
1100909317 12:99339493-99339515 CTAAATTTTGGTTGTTATAAAGG + Intronic
1101191669 12:102340122-102340144 ACAACTGCTCATTGTTCTAATGG + Intergenic
1102583336 12:113906211-113906233 CCAAATGCTCATTGGTAAAATGG + Intronic
1102813738 12:115845541-115845563 ACAAGTGCAGATTGTGATAAAGG - Intergenic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105649129 13:22354854-22354876 CCAAAATTGGATTGTTATAATGG + Intergenic
1109777681 13:67063548-67063570 CCACATTCTGATTCTGATAATGG + Intronic
1110315200 13:74098707-74098729 CCAAAGTCTGATTTGTATAATGG - Intronic
1110996834 13:82120892-82120914 CCAGATTCAGATTTTTATAAGGG - Intergenic
1111172490 13:84545896-84545918 CCAAATGCTGATTGTCCTGTAGG + Intergenic
1112539725 13:100296789-100296811 CCAAATCCTGATTTTGATTATGG - Intronic
1113845928 13:113391528-113391550 TAAAATCCTGATTGTAATAAAGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1115935711 14:38549832-38549854 ACATATGCTGATTGTGATAATGG - Intergenic
1117992451 14:61447999-61448021 TCAAATGCTGATTCTTTGAAAGG + Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1122760146 14:104018252-104018274 CCAGACGCTGATTGTTAAAACGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123975320 15:25548284-25548306 CCAATTGATGACTGTAATAATGG + Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1129504691 15:76071601-76071623 CCAAATGCTGAATGTTCCATGGG - Intronic
1129624456 15:77182192-77182214 CCAAATGCTGATTGGCTAAAGGG - Intronic
1129666712 15:77583276-77583298 CCAAATCCTGATTGTCAGAGAGG - Intergenic
1138962786 16:62047174-62047196 CCAAATGATGATTTGCATAATGG + Intergenic
1140696285 16:77537390-77537412 CCAAATCTTGTTTCTTATAATGG + Intergenic
1147486909 17:40824559-40824581 TCAAATGTTGATTGTTAAAGTGG + Intronic
1147940566 17:44044451-44044473 CCAAATGCTAAATGATGTAAGGG + Intronic
1149271743 17:54986797-54986819 ATAAATGCTTATTGTTTTAAGGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157951707 18:52045739-52045761 CCAAATGCTGACTGAGATGAGGG - Intergenic
1159081284 18:63738912-63738934 CCAGATGCTCATATTTATAACGG + Intergenic
1162248262 19:9421113-9421135 GCAAATGCTGATTGACAGAATGG + Intronic
1162845680 19:13390617-13390639 CTAACTGCTGTTTGTTATAGAGG - Intronic
1164414560 19:28035670-28035692 CCAAACTCTGATTTTTTTAATGG + Intergenic
1164499281 19:28801112-28801134 CCAAAAGCTGGTTGTTTGAAAGG + Intergenic
1164838442 19:31374134-31374156 CCAACTGCTGATTTTGATTAAGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
925667427 2:6275355-6275377 TTAAATGTTAATTGTTATAAAGG - Intergenic
926361694 2:12094108-12094130 CCAAATACTGAGTGTTTCAATGG + Intergenic
927110198 2:19859064-19859086 CCAAATGCTGATCTTTATTTGGG + Intergenic
927443549 2:23137875-23137897 CCAATTGTAGATTGTTAAAAAGG + Intergenic
928350110 2:30543817-30543839 CCAAAAGCTGATTATTTTAGGGG - Intronic
929430814 2:41884898-41884920 CCAAATGCCAATTGTGGTAAGGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931049560 2:58395706-58395728 CCAAATTCTGACTGTTCTAGTGG - Intergenic
932993082 2:76812399-76812421 ACAAATGCTGATAGGTGTAATGG + Intronic
933036627 2:77408124-77408146 CCAAAAACTGATTTTTAAAATGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938261447 2:129898314-129898336 CCAAATGCTAATAGATCTAAAGG + Intergenic
939213178 2:139204914-139204936 CCAAATGCAGATTGTTTCAGTGG + Intergenic
939406815 2:141769374-141769396 ACATATGCTAATTTTTATAAAGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
942356506 2:175118499-175118521 CCAAATTTTGTTTGTTTTAAAGG - Intronic
943200450 2:184817083-184817105 CCAAATGCTCATGGTTTTACTGG - Intronic
943672364 2:190676826-190676848 ACATATGCTTATTGTTATAAAGG - Intronic
944642393 2:201741290-201741312 CCAACTGCTGATTGTAAATATGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945604433 2:211910687-211910709 ACAAATGCCGTTTGTTATATAGG - Intronic
947310926 2:228800932-228800954 CCAAATGATCATGATTATAATGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1170836613 20:19889791-19889813 CCAGCTGCTGATTGTTACCAGGG + Intronic
1171078456 20:22152927-22152949 CCAAATGTTGATTATTGTAAGGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1174387793 20:50197640-50197662 CCCATTGCAGATTGTGATAAAGG + Intergenic
1174444542 20:50581814-50581836 CAAAAAGCTGCTTTTTATAAAGG - Intronic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178029938 21:28513051-28513073 ACACATTCTGATTGTAATAAAGG - Intergenic
1179300457 21:40104481-40104503 CCAAAAGCTAATTGATAAAAAGG + Intronic
1179507500 21:41851642-41851664 CCACCTGCTGATTGTTCAAATGG - Intronic
1180944630 22:19684831-19684853 CCAAAAGCTGATTCTTTGAAAGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951307360 3:21081817-21081839 ACACATGCAGGTTGTTATAAAGG + Intergenic
952460574 3:33521133-33521155 ATAAATAATGATTGTTATAATGG + Intronic
956135340 3:66092986-66093008 CAAAATGTTCATTTTTATAATGG - Intergenic
957287864 3:78240164-78240186 TGAGATGCTGAGTGTTATAAAGG + Intergenic
957760544 3:84549377-84549399 CCAAATGGTGATTTTTAAATAGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958206349 3:90400955-90400977 CCACATGCAGATTGTCAAAAAGG + Intergenic
958602120 3:96308410-96308432 CCAAACACTGATTGCTTTAATGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960185921 3:114638862-114638884 CCAAATGATAAATGTTTTAAAGG + Intronic
960902981 3:122570565-122570587 CCAAAAGCTGATTTTTACAGTGG + Exonic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963317480 3:143775009-143775031 CCCACTGCTGATTTTTGTAATGG + Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965401984 3:168223293-168223315 TCAGAGGCTGATTGTTCTAAGGG - Intergenic
965690734 3:171354249-171354271 CAAATTGCTGATTGTAAAAAGGG + Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970058516 4:12002438-12002460 CAAAATGGTGATTCTAATAATGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971592434 4:28485164-28485186 GCATATGGTGATTGTTTTAAAGG + Intergenic
971637620 4:29082701-29082723 CCAAAATCTGATTGTGATTATGG - Intergenic
972046673 4:34673566-34673588 CCAAATGCTGATTTTTTAATTGG - Intergenic
972793562 4:42395369-42395391 CCTGAAGCTGATTGTTGTAATGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973818531 4:54641302-54641324 CCAACTGTTGAATGTTTTAAAGG + Intergenic
974668522 4:64997300-64997322 CCAAAATTTGATTTTTATAATGG - Intergenic
974821910 4:67077765-67077787 ACAAATGCTAATTGATACAAAGG - Intergenic
977217520 4:94299331-94299353 CCATATTCTGATTTTTAAAAAGG - Exonic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977505044 4:97891351-97891373 CCAAATTCTCACTGCTATAAAGG + Intronic
978340481 4:107717396-107717418 GCAAATGCTAATTGTAATAGAGG + Intronic
978973463 4:114838896-114838918 CCAAATGGGGAGTGTTATAATGG - Intronic
980254538 4:130361471-130361493 TCAAATGCAGAATGGTATAAAGG - Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981531672 4:145760406-145760428 ACAAGTGCTGATTGCTATTAAGG + Intronic
981534853 4:145788439-145788461 TAAAATGATTATTGTTATAATGG - Intronic
981804233 4:148694629-148694651 CCTTTTGCTGATTGCTATAAGGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991943500 5:71877683-71877705 CCAAAGGCTCCTTGTTACAAAGG + Intergenic
992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG + Intronic
992923174 5:81549224-81549246 CCAAATGCTCCTTATTTTAATGG - Intronic
993073783 5:83200558-83200580 CCAAATGTTAATTTTAATAAAGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
995790772 5:115883765-115883787 GCAAAAGCTGATTTTTAAAATGG - Intronic
996665260 5:126051399-126051421 CCAAATGCTGTTTAGTAGAATGG - Intergenic
996667620 5:126078976-126078998 CCAAAGGCTGATAGTTTGAAAGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000723295 5:164735421-164735443 CCAATTACTCATTGTTAAAAAGG - Intergenic
1001553742 5:172622487-172622509 CGAGATGCTGTTTGTTGTAAAGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004395945 6:15246509-15246531 CCAAATGCTGATTGCAAAAGGGG - Exonic
1005133893 6:22544340-22544362 CCAAATGGTGATTATTTGAAAGG + Intergenic
1007811905 6:44492204-44492226 CCAAAATCTGATTGTTAAAAAGG + Intergenic
1008081710 6:47202130-47202152 CCAAATACTTATTGGCATAAAGG + Intergenic
1008660047 6:53658310-53658332 GCAAATGCTTATTGTTTTAGAGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009641205 6:66339299-66339321 TAAAATGCTGATTGTTCTAAAGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011830991 6:91371223-91371245 CAAAATGGTAATTATTATAATGG + Intergenic
1014330401 6:120056431-120056453 TCAAATGCTGCTTGCTATCACGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016086186 6:139918230-139918252 CAACATGCTCTTTGTTATAAAGG - Intergenic
1017394611 6:153982590-153982612 CCAAAAGTTGATTATTTTAAAGG - Intergenic
1017929578 6:158940020-158940042 CCAAATGCTAATGGTGACAAAGG + Intergenic
1018240231 6:161767212-161767234 GCCCATGCTGATTGTTGTAAGGG - Intronic
1018520823 6:164649285-164649307 CCAAATGCTCTTTTTTCTAAAGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020489930 7:8768835-8768857 ACAAATTCTGATTTTTATGAAGG - Intergenic
1021745119 7:23732680-23732702 CCTAAAGCTGAATGTTCTAAAGG - Intronic
1024989955 7:55225450-55225472 CAAATTGCTGAATGATATAAGGG + Intronic
1025952118 7:66153477-66153499 CCAAATCCTGAATATTAAAAAGG - Exonic
1030348858 7:108461068-108461090 CCATATTCTGATAGTTAGAATGG - Intergenic
1030436871 7:109533057-109533079 ACAATTGGTGATTCTTATAAAGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031798211 7:126206117-126206139 CCAAATGTTGATTATCTTAAGGG - Intergenic
1031974620 7:128085875-128085897 CCCAATGCTCATTGTTCTATTGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037172558 8:15910540-15910562 CCAAAGGCAGAATGTTATAGTGG - Intergenic
1037657381 8:20896789-20896811 CCAAATGATGATTAGTAGAAAGG - Intergenic
1038469504 8:27801995-27802017 CTAAATGCTGAATGTGATACTGG - Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1041196478 8:55406713-55406735 ACACATGCCCATTGTTATAAAGG + Intronic
1042051289 8:64711006-64711028 ATAAATGCAGTTTGTTATAATGG - Intronic
1042325702 8:67525582-67525604 CTGAATGCTGATTGCCATAATGG + Intronic
1042471936 8:69200077-69200099 GCAAGTGCTGATTTTTAAAATGG + Intergenic
1042668946 8:71239463-71239485 CAACATTCTGAGTGTTATAAGGG + Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044805036 8:95997787-95997809 CCAAAAGCTGATTCTTTGAAAGG + Intergenic
1045785530 8:105916389-105916411 TCATATGCTGTTTGTTATAATGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046447356 8:114340337-114340359 CCAAAGGCTGATTGTAATTAGGG + Intergenic
1048658160 8:136566339-136566361 CCAAAAGTTGATTCTTCTAAAGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1057721808 9:97537648-97537670 CCAACTCCTGATTTTTAAAATGG - Intronic
1058500429 9:105609883-105609905 CCAGATGCTTATTATTATAAAGG - Intronic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059682161 9:116596690-116596712 ACAAATGCTGAATGACATAAGGG + Intronic
1062103707 9:134741378-134741400 CCTATTGCTGCTTGTTAAAATGG - Intronic
1185922708 X:4112081-4112103 GCAAGTGCTGGTTGTTAAAAAGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191587579 X:62845574-62845596 AGAAGTGCTGATTGTTATGAAGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194014536 X:88603262-88603284 TCAAAAGCTGATTATAATAATGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1195511090 X:105716028-105716050 CCACATGCTGAGGGTTATAGAGG - Intronic
1196712551 X:118778208-118778230 CCAAATAATTATTGTAATAATGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1198484582 X:137074215-137074237 CCAAATGCTAAATGTTGAAAAGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199792036 X:151164351-151164373 CCAAATCCTGATTGTCTTTAGGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201257306 Y:12121271-12121293 ACAAATGCTGATTATTGGAAAGG + Intergenic