ID: 992278217

View in Genome Browser
Species Human (GRCh38)
Location 5:75143465-75143487
Sequence CTGTCTGTTAAGAGGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992278217_992278220 20 Left 992278217 5:75143465-75143487 CCTTCCTACCTCTTAACAGACAG 0: 1
1: 0
2: 0
3: 24
4: 252
Right 992278220 5:75143508-75143530 GAATAATGTTTAACCTGAAGTGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992278217 Original CRISPR CTGTCTGTTAAGAGGTAGGA AGG (reversed) Intronic
900493555 1:2965546-2965568 CTGTCTGTTCAGAGATATGGTGG + Intergenic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
902968998 1:20033143-20033165 CTGCCTGTTGAGAGGTAGTATGG + Intronic
903431369 1:23303245-23303267 CTATTTGTTAAGAGGCAGGAGGG - Intergenic
906712533 1:47941645-47941667 CTGTCTGTTACAAGGTTGAAAGG + Intronic
907503251 1:54899199-54899221 CAGACTGTATAGAGGTAGGAAGG + Intergenic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
910240010 1:85076118-85076140 CTGGCTGTGAAGAGGAAGGAAGG - Intronic
912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG + Intronic
913112405 1:115668194-115668216 CTATCTATTCAGAGGTAGTATGG - Intronic
916015529 1:160746481-160746503 CTTTATGTTAAGAGGCAGAAGGG + Intronic
916492017 1:165310297-165310319 CTGCCTGGTAAGAGCTTGGAGGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916747067 1:167692872-167692894 CTGGCTGGTAGGAGGTGGGAAGG + Intronic
917277119 1:173342648-173342670 TCATCTGTTAAGAGGGAGGAGGG - Intergenic
917835101 1:178935359-178935381 CTGTCTCTAAGGAAGTAGGATGG + Intergenic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
919476789 1:198039664-198039686 CAGACTGTATAGAGGTAGGAAGG - Intergenic
920180533 1:204129503-204129525 CTGTCTCATGAGAGGCAGGATGG + Intergenic
920590791 1:207216746-207216768 CTGGCATTTGAGAGGTAGGATGG - Intergenic
922935209 1:229417306-229417328 CTGACTGTATAGAGGTGGGAAGG - Intergenic
1062895372 10:1098880-1098902 CTGTCTGTTGAAAGGAAGGATGG - Intronic
1063972048 10:11388072-11388094 CTGTCTGTTAGGATCTACGAGGG + Intergenic
1065839839 10:29693385-29693407 GTGCCTGTGAAGGGGTAGGAGGG - Intronic
1066190670 10:33052898-33052920 CTTTCTGTTAAAAGGCAGGATGG + Intergenic
1066598521 10:37078401-37078423 ATGTATGTTTAGAGGTAGAATGG + Intergenic
1068006223 10:51394512-51394534 CTGGATTTTAAGAGGCAGGAGGG + Intronic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1073395125 10:103211203-103211225 CAGACTGTATAGAGGTAGGAAGG - Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1075534750 10:123261252-123261274 CTGTCTCTTAAGTTGTAGGCAGG - Intergenic
1075879450 10:125837848-125837870 CTGTCGGGGAAGAGGAAGGAGGG - Intronic
1077766067 11:5161607-5161629 CAGACTGTATAGAGGTAGGAAGG + Intronic
1079414068 11:20216504-20216526 TTGGCTGTGAAGAGGGAGGAAGG - Intergenic
1079656554 11:22992949-22992971 CTGTCTGTTACTAGGTGGGAAGG + Intergenic
1080208576 11:29758269-29758291 CTGACTGTTCAGAGGGAGCATGG - Intergenic
1081022198 11:37960086-37960108 CTGTCTGTTGGGAGTTAGGATGG + Intergenic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1081293975 11:41362814-41362836 CTGGCTGTGAAGATGAAGGAAGG - Intronic
1081400666 11:42638454-42638476 TTGTCTGTAAAGAGGCATGAGGG - Intergenic
1081503464 11:43690091-43690113 CTGTGAGTTTATAGGTAGGAGGG - Intronic
1083837395 11:65280374-65280396 CTTCCTGTTAAGAGGTTGTATGG + Intronic
1085739720 11:79068628-79068650 CTGTCTGTGAAGGGGGAGAAGGG + Intronic
1088971116 11:114775436-114775458 CAGCCTGTTGAGTGGTAGGAGGG + Intergenic
1090691888 11:129192097-129192119 CTGACTGTGAAGAGGAAGAAAGG - Exonic
1092244436 12:6855736-6855758 CTTTCTGTAAAGAAGCAGGAAGG - Exonic
1092971518 12:13700101-13700123 CTGTCTGTGGGGAGGTGGGATGG + Intronic
1093264279 12:16983167-16983189 CTGTCTGCCAAGAGGTTGGAGGG + Intergenic
1093441615 12:19204109-19204131 CTCCATGTTAAGAGGCAGGAGGG + Intronic
1093533912 12:20201142-20201164 CTGTCTCCTATGAGGTTGGAAGG + Intergenic
1093843519 12:23937034-23937056 CTGTTTGTCAAGAGCTAAGAAGG + Intronic
1094038729 12:26100203-26100225 CCTTCTTTTAAGTGGTAGGATGG - Intergenic
1094147600 12:27246344-27246366 CTTTTTGTTAAGAGGGAGAAAGG + Intronic
1094681864 12:32674355-32674377 CTGGCTTTGAAGAGGTTGGAAGG + Intergenic
1095447774 12:42299723-42299745 CTGTCTGTGAACAAGTGGGAGGG - Intronic
1095632695 12:44396966-44396988 CTTTCAGTTAAGAGGGAGGCAGG + Intergenic
1097402748 12:59149574-59149596 CTGTATGATAAGTGGTAGGTTGG - Intergenic
1097532074 12:60814553-60814575 CTGTTTTATAAGAGGTATGAAGG - Intergenic
1098323560 12:69277156-69277178 CTGTCAGATATGAGGTAGGTGGG + Intergenic
1098323715 12:69278630-69278652 CTGTCTCTTAAGAAATAGGGAGG - Intergenic
1099069168 12:78024444-78024466 TTGTCAGTTAAGAGAAAGGATGG - Intronic
1101906737 12:108832389-108832411 CTGGCTAATAAGAGGTAGAATGG + Intronic
1102401927 12:112637402-112637424 ATGTCTGGGAGGAGGTAGGAAGG - Intronic
1104795048 12:131511473-131511495 CTGTCTATTCAGAGACAGGACGG - Intergenic
1105485632 13:20828543-20828565 CTGTCTCTGAAGAGCAAGGAGGG + Intronic
1107037590 13:35917492-35917514 TTCTGTGTTTAGAGGTAGGACGG - Intronic
1107691775 13:42960775-42960797 CTGGCTTTGAAGATGTAGGAAGG - Intronic
1107803461 13:44132096-44132118 CTGTCTGGTGAGGGGAAGGAGGG + Intergenic
1109565724 13:64113953-64113975 CTGTTTCTTAAGAGTTAGGTGGG - Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1114657691 14:24325884-24325906 CTGTCTGGTGGGAGGTGGGAGGG + Exonic
1115207274 14:30922358-30922380 GTATTTGTTAAGAGGTAGGTGGG - Intronic
1117400865 14:55357525-55357547 CTGTTTATTAAGAAGTATGAAGG + Intronic
1118798671 14:69168746-69168768 CTTTCTGTACAGAGGAAGGAAGG - Intergenic
1119852536 14:77876262-77876284 CTGGCTGTAAAGATGAAGGAAGG - Intronic
1120142371 14:80942830-80942852 CTGCCTGTTGGGAGGGAGGAGGG - Intronic
1120386099 14:83847819-83847841 CTGTTTGTTCAGAGGTACTATGG + Intergenic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1120919300 14:89740345-89740367 CTAGCTGTTTACAGGTAGGAAGG + Intergenic
1121060742 14:90907073-90907095 CTGGATGTTAAGAGGGAGAAAGG - Intronic
1124076460 15:26450017-26450039 CTATCTGTTAAGAATTGGGATGG + Intergenic
1124099128 15:26677187-26677209 CTGTGATTTCAGAGGTAGGAAGG + Intronic
1124934453 15:34157041-34157063 CAGTCTGAGAAGAGCTAGGAAGG + Intronic
1125687064 15:41569853-41569875 CTGTCTCTGACCAGGTAGGAAGG + Intronic
1127866059 15:63034009-63034031 CTTCCTTTGAAGAGGTAGGAGGG - Intergenic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129174820 15:73832409-73832431 CTGTCTGTGAAGTCATAGGAGGG + Intergenic
1129259807 15:74358757-74358779 CAGACTGTATAGAGGTAGGAAGG - Intronic
1130207656 15:81892561-81892583 CTGTCTGTAAATGGGCAGGATGG - Intergenic
1130458128 15:84135446-84135468 CAATCTGTTAAGAAGAAGGAAGG + Intergenic
1130882188 15:88064871-88064893 CTGACAGTTGAGAGGGAGGAAGG + Intronic
1133002863 16:2859887-2859909 CAGTCTGTTAAGGGTTAGGGTGG + Intergenic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1135146433 16:19966796-19966818 CTGTCTGATAAGATATGGGAAGG + Intergenic
1135387781 16:22059287-22059309 CTGTCTGTTCAGATGTAATAAGG + Intronic
1137238770 16:46637295-46637317 CTGTCTGTTAAAGGGGAGGCAGG - Intergenic
1137363859 16:47843709-47843731 CAGACTGTATAGAGGTAGGAAGG - Intergenic
1137817435 16:51412060-51412082 ATCTCTGTTAAGATGTAGAAAGG - Intergenic
1138535615 16:57658783-57658805 CTATCTGTGAAGTGGGAGGATGG - Intronic
1139110160 16:63880784-63880806 CAGTATGCTAAGAGGTATGAAGG + Intergenic
1139374568 16:66488739-66488761 CTGGCTTTTAAGATGGAGGAAGG + Intronic
1139516253 16:67454038-67454060 CTGTATGTTAAGCTGTAGGCTGG + Intronic
1143062991 17:4219016-4219038 CTGTCTCTCAAGAGATTGGAAGG + Intronic
1144405037 17:14944081-14944103 CTGTATGTTAATACATAGGAAGG - Intergenic
1144805683 17:17965380-17965402 CTGGATGTTAAGAGGTAGGCGGG - Intronic
1144855585 17:18265624-18265646 AAGCCTGTTAAGAGGTAGCAAGG + Exonic
1145052417 17:19673258-19673280 CTGTCTGTTAAGAGTGAGGTAGG + Exonic
1145890217 17:28408882-28408904 CTGTCTTTTAAATGGTTGGATGG - Intergenic
1147011499 17:37452501-37452523 CTATCTCTTAAGAGAAAGGAAGG - Intronic
1147485129 17:40805444-40805466 CTGTCTTTGAAGATGAAGGATGG + Intergenic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1148583881 17:48762924-48762946 CTGCAAGTTAAGAGGTAGGAAGG + Exonic
1149220931 17:54414655-54414677 CGGACTGTAGAGAGGTAGGAAGG - Intergenic
1149531165 17:57396551-57396573 CTCTCTGTTTAGAGGCAGGGAGG + Intronic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1152095711 17:78270464-78270486 CTGTCTTCTAAGAGGCAAGATGG + Intergenic
1155274027 18:24168923-24168945 CACTCTGTGAAGAGGTTGGAAGG + Intronic
1155318904 18:24598983-24599005 CTGTGTGTTTAGAGGTTGGTTGG - Intergenic
1158576412 18:58642488-58642510 CAGACTGTATAGAGGTAGGAAGG + Intergenic
1161124347 19:2547412-2547434 GTGTCTGTGAAGGGGGAGGAAGG - Intronic
1161234349 19:3190474-3190496 CTGTCTGGGAAGCGGTGGGAGGG - Intronic
1161326908 19:3668437-3668459 GTGGCTGTGAAGAGGGAGGAAGG + Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1162420037 19:10560931-10560953 CTTTCTGTAAATAGGTTGGATGG + Intronic
1166517310 19:43457070-43457092 CTGTCTGGAAGGAGGTTGGAGGG + Intergenic
1166988068 19:46674234-46674256 CTGCCTGAAAAGAGGAAGGATGG - Intergenic
1168593584 19:57655940-57655962 CTGCCTGTTAGGAGGTGGTAGGG - Intergenic
925703032 2:6658096-6658118 CTCTCTGTTCAGAAGTAGCAAGG + Intergenic
925901901 2:8514796-8514818 CTGTCTGTGCAGAGCTAGCACGG + Intergenic
926343083 2:11920916-11920938 CTGTCTGTTTGGAGGAAGGGAGG - Intergenic
928350195 2:30544758-30544780 CTGTAAGGTAAGGGGTAGGAGGG - Intronic
931256109 2:60574437-60574459 CTATCTGTTAACCGGTTGGATGG + Intergenic
932992491 2:76805143-76805165 CTCTTTGTTTAGAGGTTGGATGG + Intronic
933940480 2:87240740-87240762 CTGGCTGTGAAGATGTGGGAAGG - Intergenic
934926675 2:98386768-98386790 CTGGCTTTGAAGATGTAGGAAGG + Intronic
935899526 2:107775862-107775884 GTGTCTCTAAAGAGATAGGAGGG - Intergenic
936352657 2:111725036-111725058 CTGGCTGTGAAGATGTGGGAAGG + Intergenic
936551323 2:113443376-113443398 CAGTCTCTTAAGAGGTTGAAGGG + Intronic
937651011 2:124319060-124319082 CTACCTGTTGAGAGGAAGGATGG + Intronic
937661670 2:124437004-124437026 CTAGCTGTAATGAGGTAGGAGGG - Intronic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
940238782 2:151540612-151540634 CTCTCTGATCAGAGGTAGCAGGG + Intronic
940486281 2:154299796-154299818 CTGTCTTTTAAGGGGGAGGAAGG + Intronic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
946407973 2:219502209-219502231 CTGGCTGTTCAGAAGTAGGGAGG + Intronic
946409385 2:219508727-219508749 TTGGCTGTTTAGGGGTAGGAGGG + Intergenic
947252790 2:228126520-228126542 CTCTTTTTTAAGAGCTAGGAAGG - Intronic
947842396 2:233216425-233216447 CTGACTGTATAGAGGTGGGAAGG + Intronic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
949035589 2:241814493-241814515 CTGTCCGTGAAGGGGTACGAGGG - Exonic
1168942887 20:1728538-1728560 CAGACTGTTTAGAGGTGGGAAGG + Intergenic
1169945412 20:10983246-10983268 GTGTCTGTTAAGAGCTAGATAGG - Intergenic
1171940307 20:31322658-31322680 CTGTCTGTTTGGATGTGGGAGGG - Intergenic
1172454487 20:35057409-35057431 CTTACTATTAAGAGTTAGGAAGG + Intronic
1172571195 20:35972185-35972207 CTGGCTGTCAAGATGAAGGAAGG - Intronic
1173331959 20:42082750-42082772 CTGTCTGTAAAGAGTTTGAAGGG - Intronic
1175711160 20:61222150-61222172 CTGGCTGTGAAGATGCAGGAAGG + Intergenic
1177628967 21:23701890-23701912 GTGTCTGTGCAAAGGTAGGATGG - Intergenic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1182998925 22:34838693-34838715 CAGACTGTATAGAGGTAGGAAGG - Intergenic
1183170234 22:36182497-36182519 CTGACTTTGAAGAGGAAGGAAGG - Intergenic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184553116 22:45216078-45216100 CTCTCTCTTCAGAGGGAGGAAGG + Intronic
1185345616 22:50309354-50309376 CAGTCAGTGAAGAGGCAGGAAGG - Exonic
950555490 3:13693337-13693359 GTGTCTGTTAGGAAGAAGGAAGG - Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951619312 3:24583508-24583530 TTGACTGGTAAGAGGAAGGAAGG - Intergenic
956366102 3:68504695-68504717 TTAACTGTTAAGAGGTTGGATGG - Intronic
956804488 3:72795610-72795632 CTCTCTTTTTAGAGGAAGGAGGG + Intronic
957128996 3:76199252-76199274 CTGGCTTTGAAGATGTAGGAAGG + Intronic
959357304 3:105348509-105348531 CTGTCTTTTGAGAGGAAGGAAGG - Intergenic
960295567 3:115939580-115939602 CTTTCTGTTAAGAGACAGGCTGG + Intronic
961188158 3:124933901-124933923 CTCTCTGTTCTGAGTTAGGAAGG - Intronic
966952528 3:184835281-184835303 CATTCTGTTAGGAGGTAGCAAGG + Intronic
967633580 3:191775619-191775641 ATGTCAGTTAAGAGGCAAGAGGG + Intergenic
967643501 3:191896675-191896697 CAGACTGTATAGAGGTAGGAAGG + Intergenic
970473100 4:16395845-16395867 GGGTCTGTTAAGAAGGAGGAAGG + Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
974637389 4:64582668-64582690 GTGGCTGTTAAGAAGGAGGAAGG + Intergenic
974904220 4:68035904-68035926 CAGACTGTATAGAGGTAGGAAGG - Intergenic
976739515 4:88344161-88344183 TTGACTGTTTAGAGGTGGGAAGG + Intergenic
979214130 4:118141881-118141903 CTGTATGTTAATAGGTTGCATGG - Intronic
979993943 4:127408624-127408646 CTGTCTGTAGTGAGGTAGGGAGG - Intergenic
981147852 4:141346791-141346813 CTGTATGTTAAGAGGGAGAAAGG - Intergenic
984346263 4:178531380-178531402 CTATATGTTAAGAGATAAGAGGG + Intergenic
985514804 5:336040-336062 CCGTCTGCTAAGAACTAGGATGG + Intronic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
987800248 5:22686666-22686688 CTGTCTCTTAATCAGTAGGATGG + Intronic
990781718 5:59372007-59372029 CTGTCTTCTAAGAGGTTTGATGG - Intronic
990949542 5:61285044-61285066 CTGTATGGTAAGGGGTAGAAGGG - Intergenic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
992810027 5:80377389-80377411 CTGTCTGGAAAGAGGAAGGAAGG + Intergenic
994154982 5:96493400-96493422 CTCTCTGTGAAGAGGCAAGATGG - Intergenic
995437788 5:112157590-112157612 CTGGCTTTGAAGATGTAGGAAGG - Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
998206346 5:140159426-140159448 CAGTCTGTTAGGAGGAAGGAGGG - Intergenic
999758833 5:154684673-154684695 CTGACTGTTAAGGGGTAGGCTGG - Intergenic
1001129563 5:169052736-169052758 CTGGGTTTTAAGTGGTAGGAAGG + Intronic
1001717861 5:173831704-173831726 CAGACTGCTAAGGGGTAGGAGGG + Intergenic
1002337160 5:178487781-178487803 CTGGCTGTTCCGAGTTAGGATGG - Intronic
1002483866 5:179521664-179521686 GTGTTTCTTATGAGGTAGGATGG - Intergenic
1003093321 6:3122423-3122445 CTGTCTGATAAGCTGTGGGAAGG + Intronic
1005298065 6:24446028-24446050 CTGTCAGTTGGGAGGCAGGATGG - Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1005849839 6:29813203-29813225 CTGTCTGCTCAGAGCTGGGAGGG - Intergenic
1006773250 6:36571523-36571545 CTGACTTTTAAGATGGAGGAAGG - Intergenic
1007743885 6:44030435-44030457 CAGTCATTTAAGAGGAAGGAAGG - Intergenic
1008525061 6:52399348-52399370 CTGTCTGTTCTGAGGGAGAAAGG - Intronic
1008601493 6:53100502-53100524 CCCTCTGCTAAGGGGTAGGAAGG - Exonic
1008964540 6:57301103-57301125 CAGTCTTTCAACAGGTAGGAAGG - Intergenic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1010865581 6:80973424-80973446 CTGTCTATGAAGATGAAGGAAGG - Intergenic
1013165682 6:107589800-107589822 CTATCTATGAAGAGGTAGGTGGG - Intronic
1013747321 6:113361086-113361108 ATTTCTGTTAAGAGATAGGGGGG + Intergenic
1013905681 6:115215383-115215405 CTGTGTGTTAAGAGTTATGTTGG - Intergenic
1016196328 6:141347032-141347054 CTCTCTGTTATGAGACAGGAAGG + Intergenic
1016535439 6:145104488-145104510 CAGACTGTAAAGAGGTGGGAAGG + Intergenic
1016634447 6:146271383-146271405 CAGACTGTAATGAGGTAGGAGGG + Intronic
1017458213 6:154622682-154622704 AAGTCTGTTACAAGGTAGGATGG + Intergenic
1017964859 6:159255316-159255338 CTGTGTGGTAGGAGGTGGGATGG - Intronic
1018176141 6:161180986-161181008 CTATCTGTAAAGATGGAGGAGGG + Intronic
1018995551 6:168707147-168707169 GTGTCTGTAAAGAGTTAGGAAGG - Intergenic
1019158926 6:170056815-170056837 CTTTTTCTTAAGAGGCAGGAAGG + Intergenic
1023173257 7:37410530-37410552 GTGTGTGTTAAGGGGTGGGAGGG - Intronic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1027221912 7:76219598-76219620 CTGTCTTTGAATAGATAGGAAGG - Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035716020 8:1755498-1755520 CTGTCTCTGAAGGGGTAGAACGG - Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1036998365 8:13687244-13687266 CTGACAGTTAACAGGTAAGAAGG + Intergenic
1039812757 8:41064238-41064260 CGGTCTGTGAAGAGGTCGAAAGG + Intergenic
1040752715 8:50729709-50729731 CTGTATGTAAAGAGGAAGGGAGG + Intronic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1041690657 8:60683389-60683411 GTGGTTGTTAAGAGCTAGGAAGG + Intronic
1042480638 8:69298236-69298258 CTGGCTTTTAAGAGGGAGGAAGG - Intergenic
1044258308 8:90091553-90091575 CAGACTGTATAGAGGTAGGAAGG + Intronic
1044742731 8:95344158-95344180 CTGTTTCTTTAGAGGTTGGAAGG - Intergenic
1045129055 8:99127834-99127856 CTGTATTTTAAAAGGTAAGAAGG + Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1048120770 8:131579086-131579108 GTGACTGTTAAGAAGGAGGATGG + Intergenic
1049018604 8:139939025-139939047 CTGTCTGTCAAGTGGCAGGGAGG - Intronic
1049203409 8:141352438-141352460 CTGTGTGTGAAGAGGCAGGGAGG + Intergenic
1049856196 8:144863459-144863481 CTGCCTGTTGCGAGGTAGTATGG + Intergenic
1049901668 9:173735-173757 CAGTCTCTTAAGAGGTTGAAGGG - Intronic
1050025938 9:1334691-1334713 CTGTATATTATGAGGAAGGAAGG - Intergenic
1052384624 9:27808607-27808629 CTGCCTGTTGAGAGGTAGTATGG + Intergenic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053744698 9:41184026-41184048 CAGTCTCTTAAGAGGTTGAAGGG - Intronic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054482572 9:65681196-65681218 CAGTCTCTTAAGAGGTTGAAGGG + Intronic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054683648 9:68247236-68247258 CAGTCTCTTAAGAGGTTGAAGGG + Intronic
1054716427 9:68561627-68561649 CTTTTTGTTAAGAGGAAGGGAGG - Intergenic
1054927253 9:70601458-70601480 CTGACTGTGAAGAGGCAGGAAGG + Intronic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1059923318 9:119181508-119181530 CTTTGTCTTAAGAGCTAGGATGG + Intronic
1061649973 9:132039737-132039759 GTGGCGGTTAAGGGGTAGGAGGG - Intronic
1186532594 X:10312292-10312314 CTGGCTTTGAAGAGGAAGGAAGG - Intergenic
1186694056 X:12010684-12010706 CTATCTGATTAGAGGCAGGATGG - Intergenic
1189082351 X:37988208-37988230 CTGGCTGTAAATAGGAAGGAAGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1190522616 X:51295670-51295692 CTTTTTTTTCAGAGGTAGGAAGG - Intergenic
1191896023 X:65994307-65994329 GTGTCAGTTATGAGGTAGGGTGG - Intergenic
1192158987 X:68768883-68768905 CTGTCTTTTCCAAGGTAGGAAGG + Intergenic
1192873609 X:75207313-75207335 CTGCCTGTTGAGAGGTATTATGG + Intergenic
1197498013 X:127209610-127209632 CTGTCTTTGAAGATGAAGGAAGG - Intergenic
1197964195 X:132039688-132039710 TTTTCTGCTAAGAGGTAGTAAGG + Intergenic
1199093650 X:143717134-143717156 TTGCCTGTTGAGAGGTAGCATGG - Intronic
1199576792 X:149320031-149320053 CAGACTGTATAGAGGTAGGAAGG - Intergenic
1201307155 Y:12560868-12560890 CAGACTGTTTAGAGGTGGGAAGG + Intergenic