ID: 992286111

View in Genome Browser
Species Human (GRCh38)
Location 5:75236983-75237005
Sequence CGCGCGCGGCCTCCCACTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992286111_992286115 -2 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286111_992286114 -3 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286114 5:75237003-75237025 GCGCGCGCGCAGGCCTACTCTGG 0: 1
1: 0
2: 0
3: 2
4: 60
992286111_992286119 29 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286119 5:75237035-75237057 GCCGCTGCGTGTTTTTTTCACGG 0: 1
1: 0
2: 0
3: 12
4: 91
992286111_992286116 3 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992286111 Original CRISPR CGCGCGCGGCCTCCCACTTC CGG (reversed) Intergenic