ID: 992286111

View in Genome Browser
Species Human (GRCh38)
Location 5:75236983-75237005
Sequence CGCGCGCGGCCTCCCACTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992286111_992286115 -2 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286111_992286114 -3 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286114 5:75237003-75237025 GCGCGCGCGCAGGCCTACTCTGG 0: 1
1: 0
2: 0
3: 2
4: 60
992286111_992286119 29 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286119 5:75237035-75237057 GCCGCTGCGTGTTTTTTTCACGG 0: 1
1: 0
2: 0
3: 12
4: 91
992286111_992286116 3 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992286111 Original CRISPR CGCGCGCGGCCTCCCACTTC CGG (reversed) Intergenic
900155881 1:1203116-1203138 CCCGCCCAGCCTCCCACTCCAGG - Intergenic
900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG + Exonic
900511624 1:3063529-3063551 CGCGCCCTGCCCCCCACTGCCGG - Intergenic
901483086 1:9539543-9539565 CGCGCGCGGGCTCCAACGCCCGG - Exonic
901489266 1:9588596-9588618 CCCGCGCCGCCTTCCACCTCCGG + Intergenic
901500982 1:9652434-9652456 CGCGCCCCGCCTCCCAGTCCCGG + Intronic
902916713 1:19644172-19644194 CGCGCGCGGCCTCTCCCTCCGGG - Intronic
904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG + Intronic
915497343 1:156291558-156291580 CCCGCTCGGCCTCCGACTACAGG + Exonic
922586583 1:226738212-226738234 CGCGGGCGCCCTCCCAGATCCGG - Intronic
924362381 1:243255061-243255083 CGCGCCCCGCCTCCCCCGTCCGG - Intronic
924944693 1:248838419-248838441 CGCGCGCGGCCTCCGAGTGGGGG - Exonic
1069837584 10:71319124-71319146 CGCGCCGGGGCTCCCCCTTCTGG - Intergenic
1076558365 10:131344967-131344989 CGCGCCCTCCCTCCCACTTGTGG - Intergenic
1076991799 11:279549-279571 CGCGCGCGTCCGCCCTCTTGAGG - Exonic
1079479581 11:20865395-20865417 CCCACCCGGCCTCCCACTTGAGG - Intronic
1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG + Intergenic
1089262539 11:117232639-117232661 CGCGCGGCACCTCCCACTTCCGG - Exonic
1092216810 12:6689232-6689254 AGCGCGCGGGCACGCACTTCTGG + Intronic
1093435317 12:19129657-19129679 CGCGCGCGCCCTACCCCCTCGGG - Intergenic
1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG + Exonic
1102300372 12:111766987-111767009 TGCGCGCTGCCGCCCGCTTCGGG + Exonic
1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG + Intergenic
1106246436 13:27954068-27954090 CGCCCGCGGCCTCCGGCGTCTGG - Intergenic
1106498733 13:30307243-30307265 CCCTCTCGGCCTCCCACTGCCGG - Intronic
1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG + Exonic
1136272207 16:29155035-29155057 CGCGCGCGTGCACTCACTTCAGG - Intergenic
1141830682 16:86508602-86508624 CGGGCGCGGCCTCTCCCTCCAGG - Intergenic
1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG + Intronic
1158896245 18:61916470-61916492 CTCTTGGGGCCTCCCACTTCCGG - Intergenic
1161264998 19:3359910-3359932 CGCGAGGGGCCCCCCACTTGGGG - Intronic
1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG + Intronic
1164664778 19:30021235-30021257 CACACCCGGCCTCCCCCTTCTGG + Intergenic
1167079126 19:47267253-47267275 CGCGCGCGGCCGAGCATTTCTGG + Intronic
1168717585 19:58538492-58538514 GGCGCGCGGCCCCCCAGATCTGG - Intronic
936467182 2:112764226-112764248 AGCGCGCAGCTTCCCACTGCTGG + Intronic
941818767 2:169824898-169824920 CGCGTGCGGCCTGGCGCTTCCGG - Exonic
1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG + Intronic
1169383262 20:5127000-5127022 CACGCGCGGACTCCCACGGCCGG - Exonic
1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG + Intergenic
1172803995 20:37598323-37598345 CGCGCGCTCCCTCCCCCTGCAGG + Intergenic
1174204419 20:48828256-48828278 TGCGCGCGGCCTCGGACTCCCGG - Intergenic
1175866794 20:62183003-62183025 CGCAAGCGGCCGACCACTTCCGG - Intergenic
1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG + Exonic
1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG + Intronic
1182904000 22:33920891-33920913 CCCGCGCGGCGGCCCACTCCTGG - Intronic
1184457983 22:44622153-44622175 CCCACTCGGCCACCCACTTCTGG - Intergenic
1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG + Intronic
950479153 3:13234020-13234042 CGCGCTCTGCATGCCACTTCCGG + Intergenic
961762828 3:129184064-129184086 CGCGCGCGGCCTTTCACGCCGGG + Intergenic
967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG + Intergenic
968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG + Intronic
968461232 4:726047-726069 CGCCCGCGGCTGCCCACTGCTGG - Intronic
969288223 4:6221850-6221872 CGAGCGAGGCCCCCCACCTCTGG + Intergenic
973820382 4:54657741-54657763 CGCGCGCGCCCTCCTCCTCCCGG + Intergenic
980915787 4:139032002-139032024 CACGCCCAGCCTCCCACTTGTGG + Intronic
982082702 4:151806108-151806130 CGCGCCCGGCCCTACACTTCTGG + Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG + Intronic
1029118752 7:98252327-98252349 GTCGCGCGCCCGCCCACTTCCGG + Intergenic
1203571724 Un_KI270744v1:139071-139093 CGCGCCCGGCCTCCCACCCATGG - Intergenic
1185610545 X:1391779-1391801 CGATCGCGGCCTTCCACTTCCGG + Intronic
1190318741 X:49167036-49167058 GGCCTGCGGTCTCCCACTTCCGG + Intronic
1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic