ID: 992286115

View in Genome Browser
Species Human (GRCh38)
Location 5:75237004-75237026
Sequence CGCGCGCGCAGGCCTACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992286098_992286115 19 Left 992286098 5:75236962-75236984 CCCCGCCCCCAGCTCCCGTGGCC 0: 1
1: 0
2: 5
3: 70
4: 616
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286100_992286115 17 Left 992286100 5:75236964-75236986 CCGCCCCCAGCTCCCGTGGCCGG 0: 1
1: 0
2: 1
3: 32
4: 419
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286103_992286115 13 Left 992286103 5:75236968-75236990 CCCCAGCTCCCGTGGCCGGAAGT 0: 1
1: 0
2: 2
3: 5
4: 87
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286105_992286115 11 Left 992286105 5:75236970-75236992 CCAGCTCCCGTGGCCGGAAGTGG 0: 1
1: 0
2: 2
3: 10
4: 109
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286099_992286115 18 Left 992286099 5:75236963-75236985 CCCGCCCCCAGCTCCCGTGGCCG 0: 1
1: 0
2: 6
3: 48
4: 483
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286102_992286115 14 Left 992286102 5:75236967-75236989 CCCCCAGCTCCCGTGGCCGGAAG 0: 1
1: 0
2: 3
3: 11
4: 161
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286104_992286115 12 Left 992286104 5:75236969-75236991 CCCAGCTCCCGTGGCCGGAAGTG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286111_992286115 -2 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286110_992286115 4 Left 992286110 5:75236977-75236999 CCGTGGCCGGAAGTGGGAGGCCG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
992286109_992286115 5 Left 992286109 5:75236976-75236998 CCCGTGGCCGGAAGTGGGAGGCC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992286115 Original CRISPR CGCGCGCGCAGGCCTACTCT GGG Intergenic
900171954 1:1273638-1273660 CGCGCTCGCAGGCCTGCGCCGGG - Intronic
901630877 1:10647592-10647614 CACGCGGGCTGGCCTGCTCTGGG + Intronic
924511328 1:244730924-244730946 GGCCCGCGCAGGCCTCTTCTCGG + Intergenic
1067686076 10:48466638-48466660 CGGCCGCGCGGGCCTACTCCGGG - Intronic
1076662529 10:132065029-132065051 TGGGCGTGCAGGCCTGCTCTGGG + Intergenic
1084521889 11:69668353-69668375 GGCACGAGCAGGCCTGCTCTGGG + Intronic
1112415523 13:99200822-99200844 CGACCGCGCAGGCGCACTCTTGG - Exonic
1122694105 14:103544505-103544527 CGCCCGTGCAGGCTTCCTCTGGG + Intergenic
1122959762 14:105089122-105089144 TGTGCGCGCACGCATACTCTGGG + Intergenic
1128636502 15:69305756-69305778 CGCCTGCGCCGGCCTACCCTGGG + Intronic
1139678066 16:68539192-68539214 CGCGCGCGCAGGCCCCGCCTAGG - Exonic
1139954370 16:70686174-70686196 CGCGGGCGCAGGCCCATTCACGG + Intergenic
1152621813 17:81368630-81368652 CGCGCCCCCAGGCCTTCTCTGGG + Intergenic
1161718830 19:5892285-5892307 CGCGCGCTGAGGCCCACCCTGGG - Exonic
1161766557 19:6211846-6211868 CGCGCCCGCAGCCCCACTCCTGG - Intergenic
1163248285 19:16110820-16110842 AGCGCGCGCCGGCCTCCTCAGGG - Intergenic
1179799027 21:43802296-43802318 GGCGCCTGCAGGCCTTCTCTGGG - Exonic
953326142 3:42013799-42013821 CCCGCGCGCGGCCCCACTCTGGG - Intronic
969288240 4:6221900-6221922 GGCGGGCGCAGGCCTCCACTGGG + Intergenic
986574405 5:9197237-9197259 CCATCGCGCAGGCCTTCTCTGGG - Exonic
992286115 5:75237004-75237026 CGCGCGCGCAGGCCTACTCTGGG + Intergenic
1006137243 6:31902405-31902427 CGCGCGCGCACCCGTTCTCTCGG + Intronic
1023651702 7:42376898-42376920 CTATCGCCCAGGCCTACTCTCGG - Intergenic
1028684252 7:93574954-93574976 CGCGAGCGCAGCCCCACTCGCGG - Intergenic
1061887513 9:133599305-133599327 TGCTCGCCCAGGCCTCCTCTGGG + Intergenic
1061996175 9:134187251-134187273 CTCGCTCCCAGGCCTGCTCTGGG - Intergenic