ID: 992286116

View in Genome Browser
Species Human (GRCh38)
Location 5:75237009-75237031
Sequence GCGCAGGCCTACTCTGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992286100_992286116 22 Left 992286100 5:75236964-75236986 CCGCCCCCAGCTCCCGTGGCCGG 0: 1
1: 0
2: 1
3: 32
4: 419
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286102_992286116 19 Left 992286102 5:75236967-75236989 CCCCCAGCTCCCGTGGCCGGAAG 0: 1
1: 0
2: 3
3: 11
4: 161
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286105_992286116 16 Left 992286105 5:75236970-75236992 CCAGCTCCCGTGGCCGGAAGTGG 0: 1
1: 0
2: 2
3: 10
4: 109
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286098_992286116 24 Left 992286098 5:75236962-75236984 CCCCGCCCCCAGCTCCCGTGGCC 0: 1
1: 0
2: 5
3: 70
4: 616
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286103_992286116 18 Left 992286103 5:75236968-75236990 CCCCAGCTCCCGTGGCCGGAAGT 0: 1
1: 0
2: 2
3: 5
4: 87
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286109_992286116 10 Left 992286109 5:75236976-75236998 CCCGTGGCCGGAAGTGGGAGGCC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286110_992286116 9 Left 992286110 5:75236977-75236999 CCGTGGCCGGAAGTGGGAGGCCG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286111_992286116 3 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286099_992286116 23 Left 992286099 5:75236963-75236985 CCCGCCCCCAGCTCCCGTGGCCG 0: 1
1: 0
2: 6
3: 48
4: 483
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
992286104_992286116 17 Left 992286104 5:75236969-75236991 CCCAGCTCCCGTGGCCGGAAGTG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992286116 Original CRISPR GCGCAGGCCTACTCTGGGCG TGG Intergenic
901005867 1:6171251-6171273 TCGAAGGCCTGTTCTGGGCGTGG - Intronic
902361354 1:15944094-15944116 GGGCAGGCCGACTCAGGGCGGGG - Intronic
903542647 1:24105601-24105623 ACCCAGGCCTAAGCTGGGCGTGG + Intronic
903745204 1:25582017-25582039 GCCCAGGCCTGCGCTGGGTGGGG - Intergenic
907021076 1:51067190-51067212 GCCCAGGCCTACCATGGGAGGGG + Intergenic
907460688 1:54603785-54603807 CTGCAGGCCTACTCTGTGCTAGG - Intronic
912432436 1:109636035-109636057 CCGCAGTCCCACTCTGGGCCAGG + Intergenic
913122417 1:115754143-115754165 GCTCAGGCCTACTTTGAGGGCGG - Intronic
921110819 1:212035226-212035248 GCGCATGTCTTCGCTGGGCGGGG - Intronic
1067831084 10:49611367-49611389 GCGCAGTCGTGCACTGGGCGTGG + Exonic
1075713874 10:124544807-124544829 CAGCAGGCCTGCTCAGGGCGTGG + Intronic
1081856632 11:46308137-46308159 GCGGAGGCCTGGGCTGGGCGGGG - Intronic
1084521890 11:69668358-69668380 GAGCAGGCCTGCTCTGGGTCTGG + Intronic
1085166157 11:74401447-74401469 GCCTAGGCCTACACTGGGTGAGG + Intergenic
1092993069 12:13921814-13921836 TCGCATGCCTACTGTGGGCCAGG - Intronic
1101050788 12:100861893-100861915 GCGTAGGCCTACACAGGGTGAGG + Intronic
1102734237 12:115143954-115143976 GCACAGGCCTACTGTGTGCCTGG - Intergenic
1107934725 13:45336039-45336061 GTGCAGGCCTAGCCTGGGAGGGG - Exonic
1113894498 13:113755091-113755113 GCCCAGCCCTGCTCTGGGCCTGG + Intergenic
1120144109 14:80960805-80960827 GCCAAGGCCTACTGTGGGCAAGG + Intronic
1125672072 15:41480896-41480918 GCCCAGGCCCACACTGGGTGGGG - Exonic
1127129136 15:55843827-55843849 TCAAAGGCCTACTCTGGGCCAGG + Intronic
1128657439 15:69472802-69472824 GGGCAGGGCTACTCTGAGCTTGG - Intergenic
1129391805 15:75224472-75224494 ACTCAGGCCGGCTCTGGGCGTGG - Intergenic
1129397166 15:75258335-75258357 GGGCCTGCCTACTCTGGGAGAGG - Intergenic
1129474385 15:75775330-75775352 GGGCCTGCCTACTCTGGGAGAGG - Intergenic
1131258590 15:90876938-90876960 GCGCAGGGCTACACAGGGCACGG + Exonic
1131692774 15:94844982-94845004 GCGCAGGCCTTCCCCGAGCGCGG + Intergenic
1131990907 15:98091698-98091720 GCGCCAGCCGACTCAGGGCGAGG + Intergenic
1132033158 15:98455477-98455499 GCCTAGGCCTACTCAGGGTGAGG - Intronic
1144698833 17:17323469-17323491 TCAAAGGCCTACTCTGGGCCAGG - Intronic
1145799651 17:27674693-27674715 TCCCAGGCCTACCCTGGGCAGGG - Intergenic
1146320835 17:31845121-31845143 GCCCAGGCCTTGGCTGGGCGCGG - Intergenic
1153728520 18:7982345-7982367 GCCTAGGCCTACTCTGGGTCAGG + Intronic
1154125555 18:11689473-11689495 GCGCCGGCCTGAACTGGGCGCGG + Exonic
1155345321 18:24851900-24851922 ACGGAGGGCTACTCTGGGCCAGG - Intergenic
1157527229 18:48393203-48393225 GGGCAGCCATACTCTGGGCAGGG - Intronic
1159051197 18:63422564-63422586 GCGCAGGCCCTCCCTGGGCCGGG + Intergenic
1166107351 19:40603930-40603952 CCCCAGGCCACCTCTGGGCGGGG - Intronic
1166158794 19:40936199-40936221 GCTGAGGCCTTCTCTGGCCGGGG + Intergenic
1166167730 19:41004103-41004125 GCTGAGGCCTTCTCTGGCCGGGG + Exonic
925294321 2:2767541-2767563 GCCCAGGCCTCCCCTGGGCCAGG + Intergenic
927276393 2:21265952-21265974 GTGCAGGCCTACTGTGTGCTAGG + Intergenic
931632116 2:64310995-64311017 ACTCAGGCCTACTATGGGCGTGG - Intergenic
932563242 2:72890179-72890201 GCGAAGGCTCACTGTGGGCGTGG + Intronic
932576152 2:72963491-72963513 TCTCAGGCCTGCTCTGGGCTGGG - Intronic
1168973272 20:1945513-1945535 CCGCAGGCCCTCTCTGGGCAAGG + Intergenic
1169088185 20:2840238-2840260 GCGCAGGCATACCCGGGTCGCGG - Exonic
1169846567 20:9999690-9999712 GCCCAGGCCTTCTCAGGGCCTGG - Intronic
1179813280 21:43885841-43885863 GCGCAGGGCTCCTGTGGGTGAGG + Intronic
1180929766 22:19581280-19581302 GTGCATGCCTATTCTGGGCGTGG - Intergenic
1181031504 22:20150540-20150562 GGACAGGGCTACCCTGGGCGAGG + Exonic
1181052002 22:20242311-20242333 GGGCACGCCCACTCTGGGCCTGG - Exonic
1181556994 22:23676902-23676924 GCACAGGCCAACTGTGGGCATGG + Intergenic
1182530832 22:30955246-30955268 GCTCAGGCCAAGGCTGGGCGTGG - Intronic
1184475833 22:44720794-44720816 GCGCACTCCTTCTCTGGGCAGGG - Intronic
1184636582 22:45836952-45836974 GTGCAGGCCCCCTCTGGGAGAGG + Intronic
961651349 3:128418122-128418144 GCGCAGGCCCAGTCTGGTCTGGG - Intergenic
962984586 3:140523129-140523151 GCCCAGGCCTGCTCTGTGCATGG - Intronic
968551770 4:1226973-1226995 GCGCTGGCCAACTGTGGGCAAGG + Intronic
968729530 4:2263002-2263024 GCGCTGGCCACCTCTGGCCGAGG + Intergenic
968891990 4:3374345-3374367 GGGGAGGCCTAGGCTGGGCGGGG + Intronic
985694323 5:1331375-1331397 GCCCAGGCCTGCGCTGGTCGGGG + Intronic
985737751 5:1594487-1594509 GCGCAGGCGTAGTCTGCGCGGGG - Intergenic
992286116 5:75237009-75237031 GCGCAGGCCTACTCTGGGCGTGG + Intergenic
992650414 5:78854026-78854048 GCGCAAGCCTAAGCAGGGCGAGG - Intronic
996533130 5:124547010-124547032 GGGCATGCCTAATCTGGGAGAGG - Intergenic
998037461 5:138929023-138929045 GCCCAGGCCTGCTGTGGGCCAGG + Intronic
999203627 5:149833281-149833303 GCGCAGGCTTGGTCTGGGCCCGG - Exonic
1001383425 5:171318536-171318558 GGGCAGGGCTCCTCTGGGCAGGG + Intergenic
1004376725 6:15096902-15096924 GTCAAGGCCTACTCTGGGAGGGG - Intergenic
1017644492 6:156526590-156526612 GCGTGGGCCTTCTCTGGGCTTGG - Intergenic
1019423384 7:962214-962236 GTGCAGGACCACTGTGGGCGAGG + Intronic
1022302318 7:29113247-29113269 ACACAGGCCTTCTCGGGGCGAGG - Intronic
1022654250 7:32304336-32304358 GCGAAGGCTTACTCTGTGCCAGG - Intergenic
1023840885 7:44096914-44096936 GGGCAGGCCTGCTGTGGGCGAGG + Intergenic
1026529735 7:71186409-71186431 CCGCAGGCCTAAGCTGAGCGGGG + Intronic
1034496879 7:151428468-151428490 GCGCAGGCCACCTCGGGGCATGG + Intergenic
1034540511 7:151755142-151755164 GCGTAGGCCGGCTCTGGGAGGGG + Intronic
1034635754 7:152566029-152566051 GCGCAGCCCTTCTTTGGGCGAGG - Intergenic
1035573718 8:690677-690699 GCGCAGCCCTGCTCTGCGCCGGG - Intronic
1035740691 8:1925999-1926021 GCACAGGACTCCTCTGGGAGAGG + Intronic
1036083722 8:5589598-5589620 GCCCAGGCCTACTCCGGGTCAGG + Intergenic
1041971866 8:63752620-63752642 CCTCAGGCCTTCTCTGGGTGGGG - Intergenic
1049294069 8:141820781-141820803 CTGCAGGCCTACCCTGGGTGTGG - Intergenic
1049403741 8:142442553-142442575 GCCCAGGCCCACTCCGGGCAAGG - Intergenic
1055394081 9:75854919-75854941 GTGCTGGCCAACTCTGGGTGAGG - Intergenic
1062298781 9:135851875-135851897 GCCCAGGCATACTCTGAGAGGGG + Intronic
1190876371 X:54463051-54463073 GAGCAGCCCTAGGCTGGGCGCGG - Intronic
1197420845 X:126235298-126235320 GCGCGGGCCTAAGCAGGGCGAGG - Intergenic