ID: 992286119

View in Genome Browser
Species Human (GRCh38)
Location 5:75237035-75237057
Sequence GCCGCTGCGTGTTTTTTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992286111_992286119 29 Left 992286111 5:75236983-75237005 CCGGAAGTGGGAGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 6
4: 60
Right 992286119 5:75237035-75237057 GCCGCTGCGTGTTTTTTTCACGG 0: 1
1: 0
2: 0
3: 12
4: 91
992286117_992286119 -4 Left 992286117 5:75237016-75237038 CCTACTCTGGGCGTGGCCTGCCG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 992286119 5:75237035-75237057 GCCGCTGCGTGTTTTTTTCACGG 0: 1
1: 0
2: 0
3: 12
4: 91
992286113_992286119 15 Left 992286113 5:75236997-75237019 CCGCGCGCGCGCGCGCAGGCCTA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 992286119 5:75237035-75237057 GCCGCTGCGTGTTTTTTTCACGG 0: 1
1: 0
2: 0
3: 12
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992286119 Original CRISPR GCCGCTGCGTGTTTTTTTCA CGG Intergenic
906366840 1:45217383-45217405 GCCACAGCCTGTTTTTTGCATGG - Intronic
907217022 1:52873028-52873050 ACCGCTGTGTGTTTTCTTAATGG - Intronic
916915987 1:169407455-169407477 GCCTCTGCATGCTTTTTTTAAGG - Intronic
917705625 1:177631345-177631367 GCTGCTGTGTGTTTTTATAATGG - Intergenic
918187953 1:182144270-182144292 GCCTCTGCTTGTTTTCTTCAGGG + Intergenic
1065721173 10:28629843-28629865 CACTCTGCGTATTTTTTTCATGG + Intergenic
1072189640 10:93069190-93069212 TCCTCTGCGTGTTTTTTCTATGG - Intergenic
1081486480 11:43533781-43533803 GCTGCTGCTTCTATTTTTCAGGG + Intergenic
1086153905 11:83644933-83644955 GCCATTGAGTGTTTTTTTAAGGG + Intronic
1092231595 12:6778592-6778614 GCTGCTTCGTGTTTCTTTCTTGG + Intergenic
1096086249 12:48867007-48867029 GGTGCTGTGTGTTTTTTTTATGG - Intergenic
1096810333 12:54165278-54165300 GCTGCTGTATGATTTTTTCAGGG - Intronic
1099944494 12:89228435-89228457 ACTGCTGAGTGTTTTTGTCAAGG + Intergenic
1101073801 12:101106887-101106909 ACTGCTGCTTTTTTTTTTCAAGG - Intronic
1102460330 12:113095907-113095929 GGCCCTGCCTGTTTTTTTCTGGG - Intronic
1102880340 12:116480311-116480333 TCCGATGCGTGTCTTTATCATGG + Intergenic
1105531357 13:21223614-21223636 GCCCCAGCATGCTTTTTTCAAGG - Intergenic
1110570352 13:76996046-76996068 GGCGCTGCCTGCTTTTTTGAGGG + Exonic
1110988705 13:82009412-82009434 GCAGCTGCTCATTTTTTTCAGGG - Intergenic
1112571098 13:100594283-100594305 GAGGCTGCTTGTTTGTTTCAAGG + Intergenic
1117578100 14:57121776-57121798 GTCGCCGCATGTTTTTGTCATGG - Intergenic
1120783150 14:88504494-88504516 ACCACTGTGTGTTTTCTTCAGGG - Exonic
1130683987 15:86021207-86021229 GCCTCTGGGTTTTTTTTTCCAGG + Intergenic
1131052812 15:89359534-89359556 GCCGTTGCGTATCTTTTTCTCGG - Intergenic
1133550718 16:6852290-6852312 GCCTCTGCGTCTTTCTTTTAAGG + Intronic
1137717732 16:50609122-50609144 GCCACTGCTTGCTTTCTTCATGG + Intronic
1137912593 16:52393264-52393286 GCCAGTGGGTGTTTGTTTCATGG - Intergenic
1143561953 17:7701728-7701750 GACTGTGCGTGTTTTTTCCACGG + Exonic
1143979035 17:10852112-10852134 GCCACTGCATGTTTTTTTGGGGG + Intergenic
1146620096 17:34390540-34390562 GTGGCTGCTTGTTTTCTTCAGGG - Intergenic
1149824409 17:59814274-59814296 GCCGATGAGTGATTTTTTTATGG + Intronic
1152121908 17:78423999-78424021 GCGGATGCGTGTTTTGTACACGG + Exonic
1152362246 17:79838078-79838100 GCCCTTGCGTGTTTATTTGAGGG - Intronic
1156061701 18:33084994-33085016 GCCTCTGCATGTTTTTCTAATGG + Intronic
1159725287 18:71950739-71950761 GCTGCTGCTTGTTTGTTTTACGG + Intergenic
1162613633 19:11777107-11777129 GCCTCAGAGTGTTTTTTTCATGG + Intronic
1162793998 19:13077367-13077389 CCCGCTGTGTGTTGTTTTCATGG + Intronic
1163796546 19:19341350-19341372 GTCGCTGCGTGTCTTCTTCCTGG + Exonic
925171157 2:1750952-1750974 GCAGCCGTGTGTTTTGTTCACGG + Intergenic
927048137 2:19300618-19300640 GGGGCTGCGTCTTCTTTTCATGG - Intergenic
927273933 2:21245496-21245518 GCCGCTGTCTGGTGTTTTCAAGG - Intergenic
934473559 2:94577498-94577520 GCCGCAGCTTTCTTTTTTCATGG + Intergenic
934627570 2:95874404-95874426 CCCGTTGCTTGTTTTTCTCAGGG - Intronic
934805998 2:97226891-97226913 CCCGTTGCTTGTTTTTCTCAGGG + Intronic
934831520 2:97530280-97530302 CCCGTTGCTTGTTTTTCTCAGGG - Intronic
935698710 2:105791762-105791784 GCAGCTGCGTCATTTTTACATGG - Intronic
936020577 2:108991702-108991724 ACCCCTGAGTGTTTTTTACAGGG - Intergenic
938760165 2:134418069-134418091 GCCACTGAGTATTTTTTTCCCGG + Intronic
939320198 2:140610000-140610022 GCCACAGGGTGTTCTTTTCAGGG + Intronic
942587468 2:177498350-177498372 GCAGCTTCATGTTTTTTTCTTGG + Intronic
942799933 2:179862889-179862911 GAAGCTGGGTGTTTTTCTCATGG - Intergenic
944938631 2:204597248-204597270 GCCGATGCGTGTTTTTTTTTTGG + Intronic
946500112 2:220238256-220238278 ACCGCAGCGTCTTCTTTTCATGG - Intergenic
947854821 2:233315998-233316020 GCTGCTGCTGGTTTTTATCATGG + Intronic
948859364 2:240745457-240745479 GCCTCTGCCTGTGTTCTTCAGGG + Exonic
1172940018 20:38647722-38647744 GCCTCTGTCTGTTCTTTTCATGG - Intronic
1177598958 21:23285937-23285959 GCTGCAGGGTGCTTTTTTCATGG - Intergenic
1182427932 22:30284655-30284677 CCCGCTGCCTGCTTTTTTCTGGG - Intergenic
1183321231 22:37166349-37166371 ACCGCTGCGTGTGTTGTACACGG + Intronic
956152988 3:66263311-66263333 TCGGCTGTGTGTTTGTTTCAGGG + Exonic
959369698 3:105507571-105507593 GTCCCTTCGTGTTTTTTTCATGG + Intronic
960604153 3:119487731-119487753 CCCACTGCTTGTTTTTGTCATGG - Intronic
963944371 3:151129431-151129453 GCCTCTTAGTGTTGTTTTCACGG + Intronic
967528955 3:190527379-190527401 GCCTCTACGTGTGTTTTGCAGGG + Intronic
977769261 4:100837748-100837770 GTTGCTGTTTGTTTTTTTCATGG + Intronic
983216943 4:165010764-165010786 GCCCCTGAGTGTTTTCTGCAAGG + Intergenic
984120336 4:175734340-175734362 TCCACTGAGTGTTTTTTACAGGG - Intronic
984468135 4:180127818-180127840 GAAGCTGCATGTTCTTTTCATGG + Intergenic
987692012 5:21279566-21279588 GCCGCTGCATTTTTTTTTAATGG - Intergenic
991748370 5:69770526-69770548 GCCGCTGCATTTTTTTTTAATGG + Intergenic
991799950 5:70350371-70350393 GCCGCTGCATTTTTTTTTAATGG + Intergenic
991828650 5:70659667-70659689 GCCGCTGCATTTTTTTTTAATGG - Intergenic
991892305 5:71349802-71349824 GCCGCTGCATTTTTTTTTAATGG + Intergenic
992286119 5:75237035-75237057 GCCGCTGCGTGTTTTTTTCACGG + Intergenic
997084396 5:130780625-130780647 GCCCCTGCTTTTTTTCTTCAGGG - Intergenic
999060808 5:148633007-148633029 GCAGCTGCATTTTTTTTTGAAGG - Intronic
999931859 5:156442128-156442150 GCCGCAGGGTTGTTTTTTCAGGG + Intronic
1000357376 5:160412794-160412816 GCAACTGCTTGTTTTTGTCAGGG - Intronic
1002700659 5:181122299-181122321 GCTGCTGCGTGTTTTTCTAAGGG - Intergenic
1002951295 6:1814431-1814453 GCAGCTGCGTTTTTTTTTTCTGG - Intronic
1007349000 6:41254910-41254932 GCCGCTTTTTTTTTTTTTCAAGG - Intergenic
1008168437 6:48169798-48169820 GCCGCTTTTTTTTTTTTTCAGGG - Intergenic
1008807109 6:55442903-55442925 GCCCCTGCCTGTTTATATCATGG - Intronic
1017123414 6:151044882-151044904 GCCGCAGCTTTCTTTTTTCATGG - Intronic
1018876219 6:167825765-167825787 GCTGCTGCGTGTTTCTTCCAGGG - Intergenic
1028153492 7:87403048-87403070 GCTTGTGTGTGTTTTTTTCATGG + Intronic
1034439696 7:151080486-151080508 GGCGCTGCGTTTTCATTTCACGG - Intronic
1034786064 7:153926752-153926774 GCAGCTGTCTGTTTATTTCATGG - Intronic
1036089549 8:5650548-5650570 GCTGCTGTGTGATTATTTCAGGG + Intergenic
1040850585 8:51898057-51898079 GCTGCTTCATGTTTTTCTCAAGG + Intronic
1043352746 8:79379919-79379941 GTGGCTGAGAGTTTTTTTCAGGG - Intergenic
1053684773 9:40511004-40511026 GCCGCAGCTTTCTTTTTTCATGG - Intergenic
1053934737 9:43139287-43139309 GCCGCAGCTTTCTTTTTTCATGG - Intergenic
1054278954 9:63113952-63113974 GCCGCAGCTTTCTTTTTTCATGG + Intergenic
1054297867 9:63346467-63346489 GCCGCAGCTTTCTTTTTTCATGG - Intergenic
1054395882 9:64650985-64651007 GCCGCAGCTTTCTTTTTTCATGG - Intergenic
1054499854 9:65865341-65865363 GCCGCAGCTTTCTTTTTTCATGG + Intergenic
1057686263 9:97237656-97237678 GAGGCTGCGTGGTCTTTTCAGGG - Intergenic
1062539323 9:137034639-137034661 GCCGCCGGGTGTCTGTTTCAAGG - Exonic
1188053221 X:25511903-25511925 GCTGCTGCTTTTTTTTTTGATGG + Intergenic
1192863927 X:75109422-75109444 TCCGTTGCTTGTTCTTTTCAAGG + Intronic
1197146469 X:123177878-123177900 GCTGCTGCATGTTCTTCTCATGG + Intergenic
1201414532 Y:13734986-13735008 ACTGCTGAGTGTTTTCTTCATGG - Intergenic
1202605294 Y:26634552-26634574 GCCGCTGTGTGTTGCTTTGAAGG - Intergenic